Journal articles: 'Field-dependent specific heat C(T,H)' – Grafiati (2024)

APA, Harvard, Vancouver, ISO, and other styles

Abstract:

We review the results of specific-heat experiments on the S = 1 quasi-one-dimensional (quasi-1D) bond-alternating antiferromagnet Ni(C 9 H 24 N 4)( NO 2) ClO 4, alias NTENP. At low temperatures above the transition temperature of a field-induced long-range order, the magnetic specific heat (C mag ) of this compound becomes proportional to temperature (T), when a magnetic field along the spin chains exceeds the critical field H c at which the energy gap vanishes. The ratio C mag /T, which increases as the magnetic field approaches H c from above, is in good quantitative agreement with a prediction of conformal field theory combined with the field-dependent velocity of the excitations calculated by the Lanczos method. This result is the first conclusive evidence for a Tomonaga–Luttinger liquid in a gapped quasi-1D antiferromagnet.

APA, Harvard, Vancouver, ISO, and other styles

Abstract:

Recently Takeuchi reported a weak, 'metamagnetic-like' increase in the magnetization around 42 T in single crystals of CeIrIn 5 for field in the c-direction. We report specific heat measurements on single crystal CeIrIn 5, H parallel c-axis, measured in the dc hybrid magnet at NHMFL in Tallahassee between 1.4 and 10 K. A clear anomaly in C/T in 35 T is observed to peak at 1.8 K, with an entropy of 6% of RIn2. This anomaly grows in size and shifts upwards in temperature (both monotonically) with increasing H until at 45 T T peak =4.1 K , with the entropy associated with the transition equal to 14% of RIn2. C/T data at 32 T show3 only the high temperature side of the peak occurring above 1.4 K, while C/T data at 28.5 T show no anomaly down to 1.4 K. This is consistent with our Tpeak vs H data, which imply T peak → 0 at 26 T.

APA, Harvard, Vancouver, ISO, and other styles

Abstract:

Abstract We report anisotropy in the superconducting properties of FeTe0.55Se0.45 bulk single crystal synthesized via the self-flux method. We have performed magnetotransport, magnetic and heat capacity measurements on single crystals of same batch. The grown crystals have also been characterized by XRD, XPS and Raman measurements. The superconductivity at T C ∼ 14 K has been affirmed by the temperature-dependent resistivity, magnetic, and specific heat measurements. The anisotropy in the upper critical field (H C2), coherence length (ξ), and critical current density (J C) have been studied from the magnetotransport and magnetic measurements, respectively, under applied magnetic fields of 0–12 T along the ab-plane and c-axis. The critical current density has been estimated by Bean’s critical state model at different magnetic fields (J C(H)) and temperatures (J C(T)) measured for H‖ab-plane and H‖c axis. The anisotropic behaviour has also been observed for J C(H). The presence of ‘peak effect’ or fishtail characteristic has been noticed in M–H loops for H‖c only, which shows a shift towards the lower fields with increasing temperature. The nature of the pinning mechanisms in the sample has been determined by the normalized pinning force density using the Dew Hughes scaling rule, and the analysis of experimental data indicates the presence of δl-pinning in the sample. The temperature-dependent electronic specific heat has been fitted with the exponential law and the evaluated coupling constant 2Δ0/kBTc is ∼3.42 which is close to the universal BCS value of 3.53. The observed low value of residual Sommerfeld coefficient γ r e s ≈ 4.59 mJ mol−1 K2 indicates good quality of the grown single crystal.

APA, Harvard, Vancouver, ISO, and other styles

Abstract:

In situ dilatometry experiments using high energy synchrotron X-ray diffraction in transmission mode were carried out at the high energy material science beamline P07@PETRAIII at DESY (Deutsches Elektronen Synchrotron) for the tempering steel AISI 4140 at defined mechanical loading. The focus of this study was on the initial tempering state ( f e r r i t e ) and the hardened state ( m a r t e n s i t e ). Lattice strains were calculated from the 2D diffraction data for different h k l planes and from those temperature-dependent lattice plane specific diffraction elastic constants ( D E C s ) were determined. The resulting coupling terms allow for precise stress analysis for typical hypoeutectoid steels using diffraction data during heat treatment processes, that is, for in situ diffraction studies during thermal exposure. In addition, by averaging h k l specific Y o u n g ′ s m o d u l i and P o i s s o n r a t i o s macroscopic temperature-dependent elastic constants were determined. In conclusion a novel approach for the determination of phase-specific temperature-dependent DECs was suggested using diffraction based dilatometry that provides more reliable data in comparison to conventional experimental procedures. Moreover, the averaging of lattice plane specific results from in situ diffraction analysis supply robust temperature-dependent macroscopic elastic constants for martensite and ferrite as input data for heat treatment process simulations.

APA, Harvard, Vancouver, ISO, and other styles

Abstract:

The combining mechanism of the itinerant carrier pair and the local carrier pair (two-component model) is considered for doped fullerenes. The superconducting transition temperature T c , penetration depth λ, coherent length ξ, thermodynamic critical field H c and specific heat jump ΔC/T c are calculated and there is overall consistency between the calculations and the experiments for both alkali-metal-doped fullerenes ( Na 3 C 60, K 3 C 60, Rb 3 C 60 and RbCs 2 C 60) and alkaline-earth doped fullerenes ( Ba 6 C 60).

APA, Harvard, Vancouver, ISO, and other styles

Abstract:

We develop a phenomenological model for high-T c superconductors. Some main features are emerging in copper oxides: characteristic quasi two-dimensional Cu-O planes, strong correlation of antiferromagnetism, existence of a vortex lattice structure, and observation of a small coherence length and a large penetration depth. These features indicate that the superconductive pair is reasonably constrained to a small volume in real space and may be conceived of as a string-carrying vortex, and therefore can be well simulated by the dual phenomenological local boson fields [Formula: see text] and Φ. The various mean-field ground states of the system are discussed. The field equations of motion are originally solved to get approximate analytical soliton solutions. The effective Hamiltonian is formulated by a variational method for finite temperatures. The model parameter behaviour described by the relationship of the variational parameters is investigated. We discuss the critical temperature T c , the specific heat cV and its jump Δc at T c , and the critical magnetic fields H c1 and H c2 . These results are in agreement with experimental observations, especially the critical behaviours and the zero temperature values. The model also allows interpretation of the variation of T c with oxygen vacancy x and that with doping fraction δ in Cu-O planes, as well as the dependence of γ (defined as the specific heat coefficient of the T-linear term) on δ.

APA, Harvard, Vancouver, ISO, and other styles

Abstract:

Abstract Orthorhombic YAlGe-type TbAlGe is expected to have an interesting magnetic anisotropy due to zigzag chains of the Tb ions. We have grown the single crystal for the first time and measured the AC magnetic susceptibility and specific heat from 1.3 K to 60 K, and the vector magnetization for the b-plane up to 7 T at 4 K. The specific heat and AC magnetic susceptibility indicate that there are two antiferromagnetic transitions at T N1 = 38 K and TN2 = 7.6 K, where the transition at T N2 is first-order like. The magnetization curve at 4 K for the a-axis shows a large hysteresis, and metamagnetic transition appears at H 1 = 1.6 T in the field increasing process, and another metamagnetic transition at H2 = 3.5 T in addition to H 1 in the decreasing field process. The magnetization curves of the b- and c-axis are linear up to 7 T. The measurement of vector magnetization at 4 K reflects the hysteresis of the magnetization curve, and there is a large hysteresis. From this vector magnetization measurement, we have made the angular magnetic field phase diagram at 4 K for the b-plane. In this phase diagram, there are phase lines that cannot be obtained by ordinary magnetization measurement.

APA, Harvard, Vancouver, ISO, and other styles

Abstract:

Terbium tritelluride, TbTe3, orders antiferromagnetically in three steps at TN1 = 6.7 K, TN2 = 5.7 K, and TN3 = 5.4 K, preceded by a correlation hump in magnetic susceptibility at T* ~8 K. Combining thermodynamic, i.e., specific heat Cp and magnetization M, and transport, i.e., resistance R, measurements we established the boundaries of two commensurate and one charge density wave modulated phases in a magnetic field oriented along principal crystallographic axes. Based on these measurements, the magnetic phase diagrams of TbTe3 at H‖a, H‖b and H‖c were constructed.

APA, Harvard, Vancouver, ISO, and other styles

Abstract:

Abstract We have successfully trapped a field of 17.89 T at 6.5 K at the center of a compact coated-conductor (CC) stacks (13 × 12 × 11.7 mm3) within 75 min by suppressing flux jumps. The CC stack consists of 200 sheets of EuBa2Cu3O7 CCs with BaHfO3 nanorods to increase the critical current density at high fields and low temperatures. To enhance thermomagnetic stability, the central 50 CCs are coated with 1 µm thick Pb with large specific heat at low temperatures. Numerical calculations based on the actual J c–H characteristics reproduces the trapped field quantitatively. New directions for achieving even higher trapped field at higher temperatures and making use of the trapped field are discussed.

APA, Harvard, Vancouver, ISO, and other styles

Abstract:

The present paper presents the computational implementation of the industrialformulation of the thermodynamic properties of water at liquid andsteam phases, proposed by the International Association for the Propertiesof Water and Steam, known as IAPWS-IF97. The validity field extends overto temperatures T between 0ºC and 800°C, for pressures p up to 100 MPa.Temperature T, specific volume v, specific enthalpy h, specific entropy s,specific heat at constant pressure cp and constant volume cv, besides saturationpressure ps, are calculated having a pair of known input values (p,T),(p,h) or (p,s). A comparative analysis between the IAPWS-IF97 routinesand others, based on foregoing propositions, from an application on Rankinecycle, is made. IAPWS-IF97 has proved to be more precise, mainly becauseit accounts for the region of compressed liquid, besides requiring less processingtime. The development is carried out as FORTRAN90 subroutinesand functions and is available for public use according to a General PublicLicense.

APA, Harvard, Vancouver, ISO, and other styles

Abstract:

We report the synthesis and superconducting properties of a layered cage compound Ba3Rh4Ge16. Similar to Ba3Ir4Ge16, the compound is composed of 2D networks of cage units, formed by noncubic Rh–Ge building blocks, in marked contrast to the reported rattling compounds. The electrical resistivity, magnetization, specific heat capacity, and μSR measurements unveiled moderately coupled s-wave superconductivity with a critical temperature T c = 7.0 K, the upper critical field μ 0 H c2(0) ∼ 2.5 T, the electron-phonon coupling strength λ e−ph ∼ 0.80, and the Ginzburg–Landau parameter κ ∼ 7.89. The mass reduction with the substitution of Ir by Rh is believed to be responsible for the enhancement of T c and coupling between the cage and guest atoms. Our results highlight the importance of atomic weight of framework in cage compounds in controlling the λ e−ph strength and T c.

APA, Harvard, Vancouver, ISO, and other styles

Abstract:

ABSTRACT Heat-labile enterotoxin from enterotoxinogenic Escherichia coli is not only an important cause of diarrhea in humans and domestic animals but also possesses potent immunomodulatory properties. Recently, the nontoxic, receptor-binding B subunit of heat-labile enterotoxin (EtxB) was found to induce the selective death of CD8+ T cells, suggesting that EtxB may trigger activation of proapoptotic signaling pathways. Here we show that EtxB treatment of CD8+ T cells but not of CD4+ T cells triggers the specific up-regulation of the transcription factorc-myc, implicated in the control of cell proliferation, differentiation, and death. A concomitant elevation in Myc protein levels was also evident, with peak expression occurring 4 h posttreatment. Preincubation with c-myc antisense oligodeoxynucleotides demonstrated that Myc expression was necessary for EtxB-mediated apoptosis. Myc activation was also associated with an increase of IκBα turnover, suggesting that elevated Myc expression may be dependent on NF-κB. When CD8+ T cells were pretreated with inhibitors of IκBα turnover and NF-κB translocation, this resulted in a marked reduction in both EtxB-induced apoptosis and Myc expression. Further, a non-receptor-binding mutant of EtxB, EtxB(G33D), was shown to lack the capacity to activate Myc transcription. These findings provide further evidence that EtxB is a signaling molecule that triggers activation of transcription factors involved in cell survival.

APA, Harvard, Vancouver, ISO, and other styles

Abstract:

Thermodynamic properties of the s–wave symmetry superconducting phase in three selected structures of the BaGe 3 compound ( P 6 3 / m m c , A m m 2 , and I 4 / m m m ) were discussed in the context of DFT results obtained for the Eliashberg function. This compound may enable the implementation of systems for quantum information processing. Calculations were carried out within the Eliashberg formalism due to the fact that the electron–phonon coupling constant falls within the range λ ∈ 0 . 73 , 0 . 86 . The value of the Coulomb pseudopotential was assumed to be 0 . 122 , in accordance with the experimental results. The value of the Coulomb pseudopotential was assumed to be 0 . 122 , in accordance with the experimental results. The existence of the superconducting state of three different critical temperature values, namely, 4 . 0 K, 4 . 5 K and 5 . 5 K, depending on the considered structure, was stated. We determined the differences in free energy ( Δ F ) and specific heat ( Δ C ) between the normal and the superconducting states, as well as the thermodynamic critical field ( H c ) as a function of temperature. A drop in the H c value to zero at the temperature of 4.0 K was observed for the P 6 3 / m m c structure, which is in good accordance with the experimental data. Further, the values of the dimensionless thermodynamic parameters of the superconducting state were estimated as: R Δ = 2 Δ ( 0 ) / k B T c ∈ { 3 . 68 , 3 . 8 , 3 . 8 } , R C = Δ C ( T c ) / C N ( T c ) ∈ { 1 . 55 , 1 . 71 , 1 . 75 } , and R H = T c C N ( T c ) / H c 2 ( 0 ) ∈ { 0 . 168 , 0 . 16 , 0 . 158 } , which are slightly different from the predictions of the Bardeen–Cooper–Schrieffer theory ( [ R Δ ] B C S = 3 . 53 , [ R C ] B C S = 1 . 43 , and [ R H ] B C S = 0 . 168 ). This is caused by the occurrence of small retardation and strong coupling effects.

APA, Harvard, Vancouver, ISO, and other styles

Abstract:

Introduction: In scrotal mammals, heat stress (43°C/ 20 min) to the scrotum results in germ cell death in the testes1, abnormal spermatozoa, and infertility2 whereas two days of whole body heating (36°C, 12 h/ day) reduces testes weight, sperm numbers and fertility3. The aim of the present study was to determine the intratesticular effects of whole body heating on germ cell maturation and apoptosis. Methods: C57BL/6 mice (n = 16) were housed at 37–38°C for 8 h/ day for 3 days while controls (n = 4) were kept at 23–24°C. Animals from heat treated (n = 4), and control groups (n = 1) were sacrificed at 16 h, 7, 14 and 21 days post exposure to heat. Testes were weighed and analysed by t-test. In testes from each animal, two sections 70µm apart were end labelled for TdT-mediated-dUTP nick (TUNEL). Apoptosis was determined in 200 seminiferous tubules by a colour threshold set in the particle analysis program (Olympus).The tubules were staged as I-VI (early), VII-VIII, IX-X and XI-XII (late) and results analysed using Wilcoxon test. Results: The weights of testes were significantly reduced in heat-treated animals (P < 0.05) at 16 h, 7 and 14 days with no significant difference at 21 days. Apoptosis was significantly higher in the heat-treated group in stages I-VI and XI-XII at 16 h, 7 and 14 days (P < 0.05). In addition, in stages VII-VIII and IX-X apoptosis was significantly higher at 16 h (P < 0.05) with no statistical difference between other time intervals. By day 21, the levels of apoptosis did not differ significantly from the controls in any of the stages (P > 0.05).Conclusion: Whole body heat stress can induce stage and cell specific degeneration of the germ cells in the seminiferous epithelium. The germ cells undergoing apoptosis are spermatogonia, primary spermatocytes and early spermatids. In addition, heat stress produces significant apoptosis of germ cells in the hormone dependent stages VII-VIII immediately after heat stress. (1) Rockett, J.C. et al. (2001) Biol. Reprod. 65:229–239. (2) Banks, S. et al. (2005) Reproduction 129:505–514. (3) Yaeram, J. et al. (2006) Reprod. Fert. Dev. 18:647–653.

APA, Harvard, Vancouver, ISO, and other styles

Abstract:

Abstract Although inflammatory monocytes (IM) [CD11b+Ly6Chi] play important roles in cell-mediated host protection against intracellular pathogens, their impact on humoral immune responses to extracellular bacteria are unknown. IM, localized largely in the splenic marginal zone of naïve CD11b-Diphtheria toxin receptor (DTR) bone marrow chimeric mice, were selectively depleted following treatment with DT, including no reduction of peritoneal B1a or B1b cells, which express CD11b. Depletion of IM resulted in a marked reduction in the polysaccharide (PS)-specific, T cell-independent IgM and T cell-dependent IgG responses to heat-killed Streptococcus pneumoniae (Pn) with no effect on the Pn protein-specific IgG response, or on the PS- and protein-specific IgG responses to a pneumococcal conjugate vaccine. IM acted largely within the first 48 h to induce the subsequent PS-specific IgM and IgG response. Adoptive transfer of highly purified IM from WT mice into DT-treated CD11b-DTR mice restored the PS-specific Ig response to Pn. IM were phenotypically and functionally distinct from circulating CD11b+CD11clowLy6G-/C- cells (i.e. “blood DC”) previously described to play a role in Ig responses to Pn. These data are the first to establish a critical role for IM in the induction of an Ig response to an intact extracellular bacterium.

APA, Harvard, Vancouver, ISO, and other styles

Abstract:

Abstract With the motivation to study how non-magnetic ion site disorder affects the quantum magnetism of Ba3CoSb2O9, a spin-1/2 equilateral triangular lattice antiferromagnet, we performed DC and AC susceptibility, specific heat, elastic and inelastic neutron scattering measurements on single crystalline samples of Ba2.87Sr0.13CoSb2O9 with Sr doping on non-magnetic Ba2+ ion sites. The results show that Ba2.87Sr0.13CoSb2O9 exhibits (i) a two-step magnetic transition at 2.7 K and 3.3 K, respectively; (ii) a possible canted 120 degree spin structure at zero field with reduced ordered moment as 1.24 μ B/Co; (iii) a series of spin state transitions for both H∥ab-plane and H∥c-axis. For H∥ab-plane, the magnetization plateau feature related to the up–up–down phase is significantly suppressed; (iv) an inelastic neutron scattering spectrum with only one gapped mode at zero field, which splits to one gapless and one gapped mode at 9 T. All these features are distinctly different from those observed for the parent compound Ba3CoSb2O9, which demonstrates that the non-magnetic ion site disorder (the Sr doping) plays a complex role on the magnetic properties beyond the conventionally expected randomization of the exchange interactions. We propose the additional effects including the enhancement of quantum spin fluctuations and introduction of a possible spatial anisotropy through the local structural distortions.

APA, Harvard, Vancouver, ISO, and other styles

Abstract:

Hammond, T. G., E. Benes, K. C. O’Reilly, D. A. Wolf, R. M. Linnehan, J. H. Kaysen, P. L. Allen, and T. J. Goodwin. Mechanical culture conditions effect gene expression: gravity-induced changes on the space shuttle. Physiol Genomics 3: 163–173, 2000.—Three-dimensional suspension culture is a gravity-limited phenomenon. The balancing forces necessary to keep the aggregates in suspension increase directly with aggregate size. This leads to a self-propagating cycle of cell damage by balancing forces. Cell culture in microgravity avoids this trade-off. We determined which genes mediate three-dimensional culture of cell and tissue aggregates in the low-shear stress, low-turbulent environment of actual microgravity. Primary cultures of human renal cortical cells were flown on the space shuttle. Cells grown in microgravity and ground-based controls were grown for 6 days and fixed. RNA was extracted, and automated gene array analysis of the expression of 10,000 genes was performed. A select group of genes were regulated in microgravity. These 1,632 genes were independent of known shear stress response element-dependent genes and heat shock proteins. Specific transcription factors underwent large changes in microgravity including the Wilms’ tumor zinc finger protein, and the vitamin D receptor. A specific group of genes, under the control of defined transcription factors, mediate three-dimensional suspension culture under microgravity conditions.

APA, Harvard, Vancouver, ISO, and other styles

Abstract:

We report a possible coexistence of nontrivial topology and antiferromagnetism in the newly discovered compounds EuCdBi2, with magnetic Eu layer locating above and below Bi square net. The X-ray diffraction on single crystals and powder indicats that this 112-type material crystalizes in space group of I4/mmm, the same as SrMnBi2 and EuMnBi2. Our combined measurements of magnetization, electrical transport and specific heat consistently reveal antiferromagnetic (AFM) transition of Eu2+ moments at TN = 20 K. The Eu moments are not saturated under a field of 7 T at 1.8 K. The anisotropic susceptibility suggests the Eu moments lie in the ab plane, and a metamagnetic (MM) transition is observed near 1 T below TN. Large positive magnetoresistance (MR) present for both H ‖ ab and H ‖ c, which are considered to contain part contributions from Dirac bands. Hall measurements show the electron-hole compensation effect is prominent above 100 K, with a crossover of Hall resistance from negative to positive values at ∼150 K. The fitted mobility of electrons is as high as 3250 cm2 V−1 S−1 at 1.8 K. Interestingly, the rapid increase of carrier density and suppression of mobility appear at around TN, indicating non-negligible interaction between Eu moments and electron/hole bands. EuCdBi2 may provide a new platform to investigate the interplay of topological bands and antiferromagnetic order.

APA, Harvard, Vancouver, ISO, and other styles

Abstract:

We have shown previously that cytoplasmic extracts from actively dividing lymphoid cells are capable of inducing DNA synthesis in isolated nuclei. One of the factors involved in this activity, ADR, appears to be a greater than 90 kDa heat-labile protease. Cytoplasmic extracts prepared from nonproliferating lymphocytes express little to no ADR activity. However, ADR activity can be generated in these extracts by brief exposure to a membrane-enriched fraction of spontaneously proliferating, leukemic human T lymphoblastoid (MOLT-4) cells. This suggests that ADR activity is present in the resting cytoplasm in an inactive or precursor form. This in vitro generation of ADR activity can be inhibited in a dose-dependent manner by the isoquinolinesulfonamide derivative, H-7 (1-(5-isoquinoline-sulfonyl)-2-methylpiperazine dihydrochloride), an inhibitor of both cyclic adenosine monophosphate (cAMP)-dependent protein kinases and protein kinase C (PKC). However, more specific inhibitors of cAMP-dependent protein kinases, including N-[( 2-methylamino)ethyl]-5-isoquinolinesulfonamide dihydrochloride (H8) and N-(2-gua-nidinoethyl)-5-isoquinolinesulfonamide (HA-1004), had little to no effect on the in vitro generation of ADR activity. Furthermore, membranes from MOLT-4 cells depleted of PKC by long-term exposure (24 h) to phorbol esters and calcium ionophores were unable to induce ADR activity in resting peripheral blood lymphocytes extracts. The results of these studies suggest 1) ADR activity is present in resting cell cytoplasm in an inactive or precursor form; and 2) ADR activity can be induced in this resting cytoplasm through a mechanism involving a membrane-associated protein kinase, possibly PKC. The ability of alkaline phosphatase to deplete the activity of preformed ADR suggests the possibility that ADR itself is phosphoprotein.

APA, Harvard, Vancouver, ISO, and other styles

Abstract:

We have separated a hole carrier and a localized spin, by treating the exchange interaction between the spins of a carrier hole and a localized spin in a mean field sense. Then we have constructed the effective one-electron-type band structure for the hole carriers in the presence of the antiferromagnetic (AF) ordering of the localized spins. In the case of the undoped La2CuO4 all the energy bands are fully occupied by electrons so that La2CuO4 is an insulator. In this sense the present energy bands which include the many body effect fully is completely different from the ordinary energy band in the local density functional method. The top of the highest valence band is at (π/a, π/a, 0)-point, and the calculated Fermi surface is small as far as the spin correlation length of the AF order is larger than the mean free path. Based on this energy band and Fermi surfaces we have calculated various normal state properties and explained their anomalous features, such as the x-dependence of the electronic specific heat, the linear temperature dependence of the resistivity down to T c , the x-dependence of the Hall coefficient with the sign change, the large T dependence of R H , the incommensurate peak of the neutron scattering and the instability at x=0.125.

APA, Harvard, Vancouver, ISO, and other styles

Abstract:

ABSTRACT The dibenzothiophene (DBT)-desulfurizing bacterium,Rhodococcus erythropolis D-1, removes sulfur from DBT to form 2-hydroxybiphenyl using four enzymes, DszC, DszA, DszB, and flavin reductase. In this study, we purified and characterized the flavin reductase from R. erythropolis D-1 grown in a medium containing DBT as the sole source of sulfur. It is conceivable that the enzyme is essential for two monooxygenase (DszC and DszA) reactions in vivo. The purified flavin reductase contains no chromogenic cofactors and was found to have a molecular mass of 86 kDa and four identical 22-kDa subunits. The enzyme catalyzed NADH-dependent reduction of flavin mononucleotide (FMN), and the Km values for NADH and FMN were 208 and 10.8 μM, respectively. Flavin adenine dinucleotide was a poor substrate, and NADPH was inert. The enzyme did not catalyze reduction of any nitroaromatic compound. The optimal temperature and optimal pH for enzyme activity were 35°C and 6.0, respectively, and the enzyme retained 30% of its activity after heat treatment at 80°C for 30 min. The N-terminal amino acid sequence of the purified flavin reductase was identical to that of DszD of R. erythropolis IGTS8 (K. A. Gray, O. S. Pogrebinsky, G. T. Mrachko, L. Xi, D. J. Monticello, and C. H. Squires, Nat. Biotechnol. 14:1705–1709, 1996). The flavin reductase gene was amplified with primers designed by using dszD ofR. erythropolis IGTS8, and the enzyme was overexpressed inEscherichia coli. The specific activity in crude extracts of the overexpressed strain was about 275-fold that of the wild-type strain.

APA, Harvard, Vancouver, ISO, and other styles

Abstract:

Abstract The susceptibility to infection by human herpes-virus 6 (HHV-6) of mature human T lymphocytes belonging to the two major subpopulations (i.e., CD3+ CD4+ CD8- and CD3+ CD4- CD8+) was investigated by using CD4+ or CD8+ T cell populations and clones derived from normal adult peripheral blood. Productive HHV-6 infection was observed in both CD4+ and CD8+ T cells. By days 2 to 6 after infection, increasing numbers of cells exhibited characteristic morphologic alterations, becoming enlarged, uniformly rounded and refractile as a consequence of the virus-induced cytopathic effect. During the course of HHV-6 infection, analysis of the surface membrane phenotype of the T cell populations and clones revealed a progressive decline in the expression of the CD3/TCR complex, whereas other T cell-associated markers (e.g., CD2) were unaffected. Northern blot analysis of mRNA extracted from HHV-6-infected T cells demonstrated a dramatic loss of the specific messages for the gamma-, delta-, and epsilon-chains of CD3. Infection by HHV-6, but not by HSV-1 or human CMV, elicited CD3/TCR down-regulation also in the neoplastic T cell line Jurkat. The down-regulation of CD3/TCR was dependent upon live virus infection, because previous inactivation of HHV-6 by heat (56 degrees C for 1 h) or UV light (16 J/m2) totally abrogated the effect. Expression of the immediate early or early genes of HHV-6 was not sufficient to induce CD3/TCR modulation, as indicated by studies with the viral DNA polymerase inhibitor phosphonoformic acid. The observation that both major subsets of mature TCR-alpha beta+ T lymphocytes are susceptible to HHV-6 infection indicates that this virus may have a broad spectrum of activity on the immune system. The transcriptional down-regulation of the CD3/TCR complex, by affecting a critical T cell recognition function, could be relevant to HHV-6 pathogenesis.

APA, Harvard, Vancouver, ISO, and other styles

Abstract:

Freshly isolated proximal tubules from the spontaneously hypertensive rat (SHR) demonstrate elevated Na+/H+ exchanger (NHE) activity, but the underlying mechanism is unclear. Because of the difficulties in preparing sufficient numbers of proximal tubule cells for detailed biochemical studies, we have generated cell lines from SHR and Wistar–Kyoto rat (WKY) proximal tubule cells. Cell lines were obtained by transforming the cells with an origin-defective mutant of simian virus 40 encoding a heat-labile T antigen (tsA58 transformant). Such cells proliferate at the permissive temperature of 33 °C, but growth is abolished at the restrictive temperature of 39 °C. The predominant NHE isoform expressed was isoform 1, as determined by sensitivity to HOE-694 (3-methylsulphonyl-4-piperidinobenzoyl guanidine) and Western blotting using specific polyclonal antisera to NHE-1. NHE-3 protein was also present. Northern blots of poly(A) mRNA extracts of the cell lines revealed a low abundance of transcripts for NHE-2, -3 and -4, with no systematic difference between the lines. Although the intracellular pH was similar in the SHR and WKY lines, HOE-694-sensitive H+ efflux due to NHE-1 was substantially elevated in SHR lines compared with WKY lines (95.0±2.8 and 39.9±5.7 mmol·min-1·l-1 respectively; P < 0.001; n = 6). H+ efflux due to non-Na+-dependent mechanisms were similar in lines from the two strains. Western blotting revealed that NHE-1 density was also very similar in SHR and WKY lines, and subcellular fractionation of hom*ogenates indicated that NHE-1 was localized predominantly to plasma membranes. Thus the turnover number of NHE-1 was increased. Immunoprecipitation of 32P-labelled phosphoproteins from these lines demonstrated an approximately 2-fold higher degree of phosphorylation of NHE-1 in SHR compared with WKY lines. These cell lines form a useful model for defining the biochemical mechanisms leading to the NHE-1 phenotype in the SHR kidney, in addition to investigations of other SHR phenotypic markers.

APA, Harvard, Vancouver, ISO, and other styles

Abstract:

We tested the hypothesis that gram-negative bacteremia (GNB) and brief (30 min) reductions in the hepatic O2 supply by low-flow ischemia differentially modulate tumor necrosis factor-alpha (TNF-alpha) gene expression owing to sequence-specific activation of cyclooxygenase vs. complement (C) pathways. Buffer-perfused Sprague-Dawley rat livers (n = 82) were studied over 180 min after intraportal 10(9) live E. coli serotype 055:B5 (EC) or 0.9% NaCl (NS) at t = 0. Compared with EC and NS controls receiving constant-flow perfusion, sequential GNB and ischemia/reperfusion (I/R) were studied in EC + 30 I/R and NS + 30 I/R livers, in which 30 min of ischemia (I) beginning 0.5 h after EC or NS was followed by 120 min of reperfusion (R). This sequence was reversed in 30 I/R + EC and 30 I/R + NS groups. Bacterial clearance, bioactive and antigenic TNF-alpha, prostaglandin E2 (PGE2), and hepatic O2 uptake and performance were serially assessed. Venous TNF-alpha increased in EC controls to peak at 155 +/- 29 U/ml after 180 min (P < 0.001 vs. NS controls) as did hepatic TNF-alpha mRNA. Both TNF-alpha transcripts and protein levels were markedly attenuated in EC + 30 I/R (P < 0.001 vs. EC) despite equivalent EC clearance by Kupffer cells. Indomethacin (10(-5) M) decreased I/R-induced PGE2 secretion and restored TNF-alpha to control levels. In contrast, TNF-alpha levels in 30 I/R + EC perfusates exceeded those of EC + 30 I/R livers (P < 0.05) and were indistinguishable from EC controls. Allopurinol pretreatment but not heat inactivation of C or infusion of soluble human complement receptor type 1 inhibited TNF-alpha production in 30 I/R + EC organs. These results identify a novel sequence-dependent interaction whereby hepatic O2 deprivation after GNB downregulates TNF-alpha via generation of cyclooxygenase metabolites, whereas ischemia preceding GNB increases cytokine expression via reactive O2 species but not C activation.

APA, Harvard, Vancouver, ISO, and other styles

Abstract:

A recombinant soluble form of human Fc gamma RII (rsFc gamma RII) was genetically engineered by the insertion of a termination codon 5' of sequences encoding the transmembrane domain of a human Fc gamma RII cDNA. Chinese hamster ovary cells were transfected with the modified cDNA and the secreted rsFc gamma RII purified from the tissue culture supernatant (to &gt; 95%, assessed by SDS-PAGE) using heat aggregated human immunoglobulin G (IgG) immunoaffinity chromatography. The IgG-purified rsFc gamma RII was relatively hom*ogeneous (approximately 31,000 M(r)) whereas the total unpurified rsFc gamma RII secreted into the tissue culture supernatant was heterogeneous relating to N-linked glycosylation differences. Functional in vitro activity of the rsFc gamma RII was demonstrated by: (a) ability to bind via the Fc portion of human IgG and mouse IgG (IgG2a &gt; IgG1 &gt; &gt; IgG2b); (b) complete inhibition of binding of erythrocytes sensitized with rabbit IgG to membrane-bound Fc gamma RII on K562 cells; and (c) inhibition of the anti-Leu4-induced T cell proliferation assay. Blood clearance and biodistribution studies show the rsFc gamma RII was excreted predominantly through the kidney in a biphasic manner, with an alpha-phase (t1/2 approximately 25 min) and a beta-phase (t1/2 approximately 4.6 h); the kidneys were the only organs noted with tissue-specific accumulation. In vivo, the administration of rsFc gamma RII significantly inhibited the immune complex-mediated inflammatory response induced by the reversed passive Arthus reaction model in rats. There was a specific and dose-dependent relationship between the amount of rsFc gamma RII administered, and the reduction in the size and severity of the macroscopic inflammatory lesion. Histological analysis of the skin showed a diffuse neutrophil infiltrate in both control and rsFc gamma RII-treated rats, however the perivascular infiltrate and the red cell extravasation was less intense in the rsFc gamma RII-treated group. It is likely that complement activation leads to neutrophil chemotaxis, but neutrophil activation via Fc gamma RII, which results in inflammatory mediator release, is inhibited. The data indicate that rsFc gamma RII is a potential therapeutic agent for the treatment of antibody or immune complex-mediated tissue damage.

APA, Harvard, Vancouver, ISO, and other styles

Abstract:

Abstract Exportin 1 (XPO1/CRM1) mediates transport of a number of cargo molecules including transcription factors and ribosomal subunits from the nucleus to cytoplasm. XPO1 is critical for cancer cell survival and proliferation, and we reported that high XPO1 expression correlates with poor prognosis in AML (Kojima, Blood, 2013). Mantle cell lymphoma (MCL) is an aggressive B-cell lymphoma that frequently shows chemoresistance. The overexpression of cyclin D1 due to the specific translocation t(l1 ;14)(q13;q32) in MCL cells is believed to be associated with oncogenesis, and additional genetic events such as mutation/overexpression of p53 are adverse prognostic indicators. Since a number of signaling pathways are dysregulated in MCL, novel strategies aimed at restoring multiple anti-oncogenic pathways, are of considerable interest. We have previously reported anti-proliferative effects of the small molecule SINE XPO1 antagonist KPT-185 in MCL cells, in which KPT-185 abrogates MCL-related cyclin Dl overexpression and upregulates pro-apoptotic PUMA in a p53-independent manner (Tabe, ASH. 2012). In this study, we identified pro-survival pathways involved in XPO1-dependent nuclear export in MCL cells, using the isobaric tags for relative and absolute quantification (iTRAQ) with two-dimensional-liquid chromatography-tandem mass spectrometry. Two MCL cell lines with known p53 status and sensitivities to KPT-185 were analyzed; wt-p53 Zl38 (IC50 35 nM, ED50 62 nM) and mt-p53 Jeko-1 (IC50 103 nM, ED50 618 nM). iTRAQ proteomics identified a total of 2,255 unique proteins in Zl38 and of 2,179 in Jeko-1 cells (KPT-185 of 50 nM for Zl38 and 100 nM for Jeko-1, 18 h), including 75 proteins (62 downregulated and 13 upregulated proteins) consistently altered after KPT-185 treatment in both cells lines. Notably, 81% of the downregulated proteins (50/62) were ribosomal proteins, and iTRAQ further detected the significant repressions of EIF4A1/PIM2 (eukaryotic translation initiation factor 4A1) and EEF2 (eukaryotic elongation factor 2), suggesting that KPT-185 inhibited the XPO1-dependent nuclear export of ribosomal subunits, which led to a defect of ribosomal biogenesis. Very recently, the coordination between the net translational activity of ribosomal biogenesis and the transcriptional regulation via the multifaceted transcription factor HSF1 (heat shock factor 1) has been reported (Santagata, Science, 2013) and HSF1 was identified as a prime transducer that regulates a transcriptional network of genes driving heat-shock proteins, protein synthesis, and energy metabolism. In our study, iTRAQ consistently detected the KPT-185 induced decreased protein levels of HSF1 target HSP70 (Heat shock protein 70), FASN (Fatty acid synthase), phospho-HSP90 (Heat shock protein 90) and EEF1A1 (Eukaryotic translation elongation factor 1 alpha 1), and increased levels of phospho-HNRNPD (Heterogeneous nuclear ribonucleoprotein D, a nucleic acid binding protein which contributes pre-mRNA processing in nucleus). These results indicate that XPO1 may also be affecting transcriptional processes critical for cellular metabolism and survival. Translation initiation factor EIF4Al/PlM2 is known to be associated with an aggressive clinical course in B-cell lymphomas (Gomez-Abad, Blood. 2011), and downregulation of PIM1 kinase via ribosomal protein deficiency induces cell-cycle inhibitor p27KIP (Morish*ta, Cancer Res. 2008) and inhibits oncogenic transcription factor c-Myc (Iadevaia, Oncogene. 2010). Of note, iTRAQ detected the KPT-185 induced depletion of ribosomal proteins RPS19 and RPL11, which interact with PIM1 kinase and c-Myc, respectively. We confirmed KPT-185 induced downregulation of PIM1 and c-Myc and upregulation of p27KIP by Western blot. KPT-185 further reduced phospho-S6K, a substrate of mTORC1 and a major negative regulatory axis of autophagy, and induced a shift from LC3-I to LC3-II, suggesting that CRM1 inhibition by KPT-185 causes autophagy through suppression of mTOR signaling. In summary, this is the first investigation of XPO1 inhibition in MCL cells using the iTRAQ proteomics approach. The results suggest that XPO1 inhibition targets ribosomal biogenesis, in addition to its nuclear retention of numerous client proteins including p53. This finding elucidates a novel mechanism and target of KPT-185 and warrants further investigations. Disclosures: Andreeff: Karyopharm Therapeutics: Research Funding.

APA, Harvard, Vancouver, ISO, and other styles

Abstract:

Abstract Introduction: Chronic myeloid leukaemia (CML) is a myeloid neoplasm defined by the Bcr/Abl oncoprotein that is considered essential for leukaemogenesis and accumulation of neoplastic cells. Evidence exists showing that extracts of antichoke Cynara cardunculus L. (CCE) are able to inhibit cancer cell growth in vitro (1). In the present study we have investigated the antiproliferative effect of methanolic extract of CEE on K562 Bcr-Abl positive leukemia cell line. In addition we evaluated whether the extract of CEE also affects the mRNA levels of Bcr-Abl and p210 expression in this cell line. Materials and Methods: Preparation of methanolic extract of CEE. The aerial parts of CEE were air dried until dryness at room temperature, cut into small pieces and then extracted with methanol through maceration (48 h for 3 times). The resultant total extracts were dried under reduced pressure and their weight was determined. Cell culture. The K562 cells were grown in RPMI 1640 with L-glutamine supplemented with 10% (v/v) heat-inactivated FBS, 1% penicillin/streptomycin in humidified atmosphere of 5% CO2 at 37°C. In all experiments growing cells at optimal concentration were placed in 24 or 96 well plate and then treated with vehicle or 5–100–200 μg/ml methanolic extract of CEE. 48h after the treatment cultures were tested for proliferative activity, mRNA level of Bcr-Abl by RT-PCR and p210 protein expression by western blotting analysis. Proliferative activity. Proliferative activity was determined using the MTT technique according to the method described by Tubaro et al. (1996). The assay was performed in triplicate and absorbance values at 550 nm were measured using a microplate reader. RT-PCR Analysis. The total cellular mRNA was isolated from treated and control cells using an silica coloumns. Using equal amounts of the RNA from each sample, the cDNA was synthesized by Superscript VILO™ cDNA kit. PCR was performed using Platinum® Taq DNA polymerase and specific primers for t(9;22) p210 transcripts (b3a2): GAAGTGTTTCAGAAGCTTTCC (sense) and GTTTGGGCT-TCACACCATTCC (antisense). 35 amplification cycles were performed at 94°C for 30s, 55°C for 30s and 72°C for 1min. Gel electrophoresis and ethidium bromide staining was used to visualize the PCR products. Western Blot Analysis. Cell pellets from control and treated cultures were lysed using lysis buffer with protease and phosphatase inhibitors. The proteins were then quantified and equal amounts (30 ug) were separated by SDS-PAGE and electro-blotted to nitrocellulose. After blocking procedure the blots were incubated with specific primary antibody against p210 protein and then challenged with specific horseradish peroxidase-conjugated secondary antibody. The reactive protein was visualized using an enhanced chemiluminescence detection system. Results: The results have shown that treatment of K562 cell line with methanolic extract of CEE reduced cell viability in a dose-dependent fashion (IC50=41.7 μg/ml) as demonstrated by MTT assay. PCR and Western blot analysis revealed that the cell growth inhibition was associated to a dramatic decrease of mRNA levels of Bcr-Abl and to a significant reduction of p210 protein expression suggesting that the antiproliferative effect of methanolic extract of CEE likely due to the inhibition at transcriptional level of Bcr-Abl oncoprotein. Further studies are needed to better elucidate this mechanisms and to identify the compound of crude extract which is responsible of cancer growth suppression.

APA, Harvard, Vancouver, ISO, and other styles

Abstract:

During 2006 and 2007 in the region of Sumaré, state of São Paulo, Brazil, surveys were done on tomato (Solanum lycopersicum L.) virus diseases in three open field-grown crops. The data revealed low incidence (0.25 to 3.42%) of randomly distributed plants exhibiting interveinal chlorosis and some necrosis on the basal leaves. Symptoms were only observed on old fruit-bearing plants. Preliminary analysis of thin sections of symptomatic leaves from one plant by transmission electron microscopy revealed the presence of aggregates of thin, flexible, and elongated particles in some phloem vessels, suggesting infection with a member of the genus Crinivirus, family Closteroviridae. Total RNA was extracted separately from leaves of 10 symptomatic plants and used for one-step reverse transcription (RT)-PCR using the HS-11/HS-12 primer pair, which amplifies a fragment of 587 bp from the highly conserved region of the heat shock protein (HSP-70) hom*olog gene reported for Tomato infectious chlorosis virus (TICV) and Tomato chlorosis virus (ToCV) (1). The RT-PCR product was subsequently tested by nested-PCR for single detection of TICV and ToCV using primer pairs TIC-3/TIC-4 and ToC-5/ToC-6, respectively (1). Only one fragment of approximately 463 bp was amplified from 7 of the 10 plants with the primer pair specific for ToCV. No amplification was obtained with the primers specific for TICV. Two amplicons of 463 bp were purified and directly sequenced in both directions. Sequence comparisons of the 463-bp consensus sequence (GenBank Accession No. EU868927) revealed 99% identity with the reported sequence of ToCV from the United States (GenBank Accession No. AY903448) (3). Virus-free adults of Bemisia tabaci biotype B confined on symptomatic tomato leaves for a 24-h acquisition access period were able to transmit the virus to healthy tomato plants, which reproduced the original symptoms on the bottom leaves 65 days after inoculation under greenhouse conditions. Infection from transmission was confirmed by RT-PCR using the HS-11/HS-12 primer pair. In addition to B. tabaci biotype B, the greenhouse whitefly, Trialeurodes vaporariorum, has also been reported as a vector of ToCV, although it is less efficient than the B. tabaci biotype B in transmission of this virus (4). T. vaporariorum, which was previously considered limited to greenhouses, was recently reported in tomato and green bean (Phaseolus vulgaris L.) crops under field conditions in São Paulo State (2). Therefore, it might also contribute to the spread of ToCV in tomato crops in São Paulo. To our knowledge, this is the first report of ToCV in Brazil and South America. References: (1) C. I. Dovas et al. Plant Dis.86:1345, 2002. (2) A. L. Lourenção et al. Neotrop. Entomol. 37:89, 2008. (3) W. M. Wintermantel et al. Arch. Virol. 15:2287, 2005. (4) W. M. Wintermantel and G. C. Wisler. Plant Dis. 90:814, 2006.

APA, Harvard, Vancouver, ISO, and other styles

Abstract:

The gap function in unconventional superconductors may vanish at points or lines in momentum space, permitting electronic excitations, termed "nodal quasiparticles", to exist at temperatures well below the superconducting transition. In the vortex phase, the presence of nodal quasiparticles should be directly observable through the variation of the heat capacity with the angle between a magnetic field and the location of the zeroes of the gap. The heat capacity of candidate nonmagnetic unconventional superconductors Lu ( Y ) Ni 2 B 2 C were found to exhibit fourfold oscillations with field angle, the first such observation. The observed angular variations are in quantitative agreement with theory, confirming that quasiparticles are created via Doppler shifts at nodes along <100>. Anomalous disorder effects have been also observed in the field-angle-dependent heat capacity Cp(α). In a slightly disordered sample, anomalous secondary minima along <110> appeared for μ0H>1 T , leading to an eightfold pattern. The coexistence of an anisotropic superconducting gap and nonlocal effects is shown to drive the anomalous behavior. These results demonstrate that field-angle-dependent heat capacity can be a powerful tool in probing the momentum-space gap structure in unconventional superconductors such as high-Tc cuprates, heavy fermions, borocarbides, etc.

APA, Harvard, Vancouver, ISO, and other styles

Abstract:

Observed temperature-dependent heat capacity C (T) behavior of high-Tc YBa 2 Cu 3 O 7-δ cuprate superconductors has been theoretically analyzed in the temperature domain 70 ≤ T ≤ 110 K . Calculations of C (T) have been made within the two component scheme: one is the Fermionic term and the other the Bosonic (phonon) contribution. While estimating the electronic term, we use a mean field step and follow two-fluid model below and above Tc. Later on, the lattice heat capacity is estimated within harmonic approximation for high temperature expansion (T > θ/2π), the model has only one free parameter, the moments of phonon density of states. Within the two-fluid model for electronic specific heat along with reported γ value leads to a sharp discontinuity at Tc. The Coulomb correlations and electron-phonon coupling strength have significant implications on the γ. Henceforth, the present numerical analysis of specific heat from the present model shows similar results as those revealed from experiments. The accurate fitting of the specific heat data reveals that it is possible to decompose the documented specific heat into dominant lattice contribution and electronic channel. However, the specific heat from electronic term is only a fraction of lattice specific heat in YBa 2 Cu 3 O 7-δ high-Tc superconductors.

APA, Harvard, Vancouver, ISO, and other styles

Abstract:

Abstract We report superconducting state properties and electronic structure of a full Heusler material ScAu2Al. The resistivity measurement indicates a zero-field (at nominal Earth’s field) superconducting transition temperature, T c = 5.12 K (in contrary to the previously reported value of 4.4 K), which falls in the highest T c -regime among the Heusler superconductors. The magnetization data shows that ScAu2Al is a moderate type-II superconductor, where the critical field values can be estimated from the Ginzburg–Landau–Abrikosov–Gorkov theory. The field-dependent magnetization response further shows signatures of flux jump in ScAu2Al. A sharp jump in the temperature dependent specific heat (C p ) data confirms bulk superconductivity. We report that the electron–phonon coupling constant, λ e–ph = 0.77, suggesting a moderate electron–phonon coupling in ScAu2Al. Further, we show that the observed λ e–ph value in ScAu2Al is the highest amongst the reported Heusler superconductors, indicating strong correlation between T c and λ e–ph values and significant role of electron–phonon coupling in mediating superconductivity in Heusler superconductors. Finally, we discuss the electronic properties and reveal the existence of van Hove singularity near the Fermi level in ScAu2Al.

APA, Harvard, Vancouver, ISO, and other styles

Abstract:

Rapid urbanization rates impact significantly on the nature of Land Cover patterns of the environment, which has been evident in the depletion of vegetal reserves and in general modifying the human climatic systems (Henderson, et al., 2017; Kumar, Masago, Mishra, & f*ckushi, 2018; Luo and Lau, 2017). This study explores remote sensing classification technique and other auxiliary data to determine LULCC for a period of 50 years (1967-2016). The LULCC types identified were quantitatively evaluated using the change detection approach from results of maximum likelihood classification algorithm in GIS. Accuracy assessment results were evaluated and found to be between 56 to 98 percent of the LULC classification. The change detection analysis revealed change in the LULC types in Minna from 1976 to 2016. Built-up area increases from 74.82ha in 1976 to 116.58ha in 2016. Farmlands increased from 2.23 ha to 46.45ha and bared surface increases from 120.00ha to 161.31ha between 1976 to 2016 resulting to decline in vegetation, water body, and wetlands. The Decade of rapid urbanization was found to coincide with the period of increased Public Private Partnership Agreement (PPPA). Increase in farmlands was due to the adoption of urban agriculture which has influence on food security and the environmental sustainability. The observed increase in built up areas, farmlands and bare surfaces has substantially led to reduction in vegetation and water bodies. The oscillatory nature of water bodies LULCC which was not particularly consistent with the rates of urbanization also suggests that beyond the urbanization process, other factors may influence the LULCC of water bodies in urban settlements. Keywords: Minna, Niger State, Remote Sensing, Land Surface Characteristics References Akinrinmade, A., Ibrahim, K., & Abdurrahman, A. (2012). Geological Investigation of Tagwai Dams using Remote Sensing Technique, Minna Niger State, Nigeria. Journal of Environment, 1(01), pp. 26-32. Amadi, A., & Olasehinde, P. (2010). Application of remote sensing techniques in hydrogeological mapping of parts of Bosso Area, Minna, North-Central Nigeria. International Journal of Physical Sciences, 5(9), pp. 1465-1474. Aplin, P., & Smith, G. (2008). Advances in object-based image classification. The International Archives of the Photogrammetry, Remote Sensing and Spatial Information Sciences, 37(B7), pp. 725-728. Ayele, G. T., Tebeje, A. K., Demissie, S. S., Belete, M. A., Jemberrie, M. A., Teshome, W. M., . . . Teshale, E. Z. (2018). Time Series Land Cover Mapping and Change Detection Analysis Using Geographic Information System and Remote Sensing, Northern Ethiopia. Air, Soil and Water Research, 11, p 1178622117751603. Azevedo, J. A., Chapman, L., & Muller, C. L. (2016). Quantifying the daytime and night-time urban heat island in Birmingham, UK: a comparison of satellite derived land surface temperature and high resolution air temperature observations. Remote Sensing, 8(2), p 153. Blaschke, T., Hay, G. J., Kelly, M., Lang, S., Hofmann, P., Addink, E., . . . van Coillie, F. (2014). Geographic object-based image analysis–towards a new paradigm. ISPRS Journal of Photogrammetry and Remote Sensing, 87, pp. 180-191. Bukata, R. P., Jerome, J. H., Kondratyev, A. S., & Pozdnyakov, D. V. (2018). Optical properties and remote sensing of inland and coastal waters: CRC press. Camps-Valls, G., Tuia, D., Bruzzone, L., & Benediktsson, J. A. (2014). Advances in hyperspectral image classification: Earth monitoring with statistical learning methods. IEEE signal processing magazine, 31(1), pp. 45-54. Chen, J., Chen, J., Liao, A., Cao, X., Chen, L., Chen, X., . . . Lu, M. (2015). Global land cover mapping at 30 m resolution: A POK-based operational approach. ISPRS Journal of Photogrammetry and Remote Sensing, 103, pp. 7-27. Chen, M., Mao, S., & Liu, Y. (2014). Big data: A survey. Mobile networks and applications, 19(2), pp. 171-209. Cheng, G., Han, J., Guo, L., Liu, Z., Bu, S., & Ren, J. (2015). Effective and efficient midlevel visual elements-oriented land-use classification using VHR remote sensing images. IEEE transactions on geoscience and remote sensing, 53(8), pp. 4238-4249. Cheng, G., Han, J., Zhou, P., & Guo, L. (2014). Multi-class geospatial object detection and geographic image classification based on collection of part detectors. ISPRS Journal of Photogrammetry and Remote Sensing, 98, pp. 119-132. Coale, A. J., & Hoover, E. M. (2015). Population growth and economic development: Princeton University Press. Congalton, R. G., & Green, K. (2008). Assessing the accuracy of remotely sensed data: principles and practices: CRC press. Corner, R. J., Dewan, A. M., & Chakma, S. (2014). Monitoring and prediction of land-use and land-cover (LULC) change Dhaka megacity (pp. 75-97): Springer. Coutts, A. M., Harris, R. J., Phan, T., Livesley, S. J., Williams, N. S., & Tapper, N. J. (2016). Thermal infrared remote sensing of urban heat: Hotspots, vegetation, and an assessment of techniques for use in urban planning. Remote Sensing of Environment, 186, pp. 637-651. Debnath, A., Debnath, J., Ahmed, I., & Pan, N. D. (2017). Change detection in Land use/cover of a hilly area by Remote Sensing and GIS technique: A study on Tropical forest hill range, Baramura, Tripura, Northeast India. International journal of geomatics and geosciences, 7(3), pp. 293-309. Desheng, L., & Xia, F. (2010). Assessing object-based classification: advantages and limitations. Remote Sensing Letters, 1(4), pp. 187-194. Dewan, A. M., & Yamaguchi, Y. (2009). Land use and land cover change in Greater Dhaka, Bangladesh: Using remote sensing to promote sustainable urbanization. Applied Geography, 29(3), pp. 390-401. Dronova, I., Gong, P., Wang, L., & Zhong, L. (2015). Mapping dynamic cover types in a large seasonally flooded wetland using extended principal component analysis and object-based classification. Remote Sensing of Environment, 158, pp. 193-206. Duro, D. C., Franklin, S. E., & Dubé, M. G. (2012). A comparison of pixel-based and object-based image analysis with selected machine learning algorithms for the classification of agricultural landscapes using SPOT-5 HRG imagery. Remote Sensing of Environment, 118, pp. 259-272. Elmhagen, B., Destouni, G., Angerbjörn, A., Borgström, S., Boyd, E., Cousins, S., . . . Hambäck, P. (2015). Interacting effects of change in climate, human population, land use, and water use on biodiversity and ecosystem services. Ecology and Society, 20(1) Farhani, S., & Ozturk, I. (2015). Causal relationship between CO 2 emissions, real GDP, energy consumption, financial development, trade openness, and urbanization in Tunisia. Environmental Science and Pollution Research, 22(20), pp. 15663-15676. Feng, L., Chen, B., Hayat, T., Alsaedi, A., & Ahmad, B. (2017). The driving force of water footprint under the rapid urbanization process: a structural decomposition analysis for Zhangye city in China. Journal of Cleaner Production, 163, pp. S322-S328. Fensham, R., & Fairfax, R. (2002). Aerial photography for assessing vegetation change: a review of applications and the relevance of findings for Australian vegetation history. Australian Journal of Botany, 50(4), pp. 415-429. Ferreira, N., Lage, M., Doraiswamy, H., Vo, H., Wilson, L., Werner, H., . . . Silva, C. (2015). Urbane: A 3d framework to support data driven decision making in urban development. Visual Analytics Science and Technology (VAST), 2015 IEEE Conference on. Garschagen, M., & Romero-Lankao, P. (2015). Exploring the relationships between urbanization trends and climate change vulnerability. Climatic Change, 133(1), pp. 37-52. Gokturk, S. B., Sumengen, B., Vu, D., Dalal, N., Yang, D., Lin, X., . . . Torresani, L. (2015). System and method for search portions of objects in images and features thereof: Google Patents. Government, N. S. (2007). Niger state (The Power State). Retrieved from http://nigerstate.blogspot.com.ng/ Green, K., Kempka, D., & Lackey, L. (1994). Using remote sensing to detect and monitor land-cover and land-use change. Photogrammetric engineering and remote sensing, 60(3), pp. 331-337. Gu, W., Lv, Z., & Hao, M. (2017). Change detection method for remote sensing images based on an improved Markov random field. Multimedia Tools and Applications, 76(17), pp. 17719-17734. Guo, Y., & Shen, Y. (2015). Quantifying water and energy budgets and the impacts of climatic and human factors in the Haihe River Basin, China: 2. Trends and implications to water resources. Journal of Hydrology, 527, pp. 251-261. Hadi, F., Thapa, R. B., Helmi, M., Hazarika, M. K., Madawalagama, S., Deshapriya, L. N., & Center, G. (2016). Urban growth and land use/land cover modeling in Semarang, Central Java, Indonesia: Colombo-Srilanka, ACRS2016. Hagolle, O., Huc, M., Villa Pascual, D., & Dedieu, G. (2015). A multi-temporal and multi-spectral method to estimate aerosol optical thickness over land, for the atmospheric correction of FormoSat-2, LandSat, VENμS and Sentinel-2 images. Remote Sensing, 7(3), pp. 2668-2691. Hegazy, I. R., & Kaloop, M. R. (2015). Monitoring urban growth and land use change detection with GIS and remote sensing techniques in Daqahlia governorate Egypt. International Journal of Sustainable Built Environment, 4(1), pp. 117-124. Henderson, J. V., Storeygard, A., & Deichmann, U. (2017). Has climate change driven urbanization in Africa? Journal of development economics, 124, pp. 60-82. Hu, L., & Brunsell, N. A. (2015). A new perspective to assess the urban heat island through remotely sensed atmospheric profiles. Remote Sensing of Environment, 158, pp. 393-406. Hughes, S. J., Cabral, J. A., Bastos, R., Cortes, R., Vicente, J., Eitelberg, D., . . . Santos, M. (2016). A stochastic dynamic model to assess land use change scenarios on the ecological status of fluvial water bodies under the Water Framework Directive. Science of the Total Environment, 565, pp. 427-439. Hussain, M., Chen, D., Cheng, A., Wei, H., & Stanley, D. (2013). Change detection from remotely sensed images: From pixel-based to object-based approaches. ISPRS Journal of Photogrammetry and Remote Sensing, 80, pp. 91-106. Hyyppä, J., Hyyppä, H., Inkinen, M., Engdahl, M., Linko, S., & Zhu, Y.-H. (2000). Accuracy comparison of various remote sensing data sources in the retrieval of forest stand attributes. Forest Ecology and Management, 128(1-2), pp. 109-120. Jiang, L., Wu, F., Liu, Y., & Deng, X. (2014). Modeling the impacts of urbanization and industrial transformation on water resources in China: an integrated hydro-economic CGE analysis. Sustainability, 6(11), pp. 7586-7600. Jin, S., Yang, L., Zhu, Z., & Homer, C. (2017). A land cover change detection and classification protocol for updating Alaska NLCD 2001 to 2011. Remote Sensing of Environment, 195, pp. 44-55. Joshi, N., Baumann, M., Ehammer, A., Fensholt, R., Grogan, K., Hostert, P., . . . Mitchard, E. T. (2016). A review of the application of optical and radar remote sensing data fusion to land use mapping and monitoring. Remote Sensing, 8(1), p 70. Kaliraj, S., Chandrasekar, N., & Magesh, N. (2015). Evaluation of multiple environmental factors for site-specific groundwater recharge structures in the Vaigai River upper basin, Tamil Nadu, India, using GIS-based weighted overlay analysis. Environmental earth sciences, 74(5), pp. 4355-4380. Koop, S. H., & van Leeuwen, C. J. (2015). Assessment of the sustainability of water resources management: A critical review of the City Blueprint approach. Water Resources Management, 29(15), pp. 5649-5670. Kumar, P., Masago, Y., Mishra, B. K., & f*ckushi, K. (2018). Evaluating future stress due to combined effect of climate change and rapid urbanization for Pasig-Marikina River, Manila. Groundwater for Sustainable Development, 6, pp. 227-234. Lang, S. (2008). Object-based image analysis for remote sensing applications: modeling reality–dealing with complexity Object-based image analysis (pp. 3-27): Springer. Li, M., Zang, S., Zhang, B., Li, S., & Wu, C. (2014). A review of remote sensing image classification techniques: The role of spatio-contextual information. European Journal of Remote Sensing, 47(1), pp. 389-411. Liddle, B. (2014). Impact of population, age structure, and urbanization on carbon emissions/energy consumption: evidence from macro-level, cross-country analyses. Population and Environment, 35(3), pp. 286-304. Lillesand, T., Kiefer, R. W., & Chipman, J. (2014). Remote sensing and image interpretation: John Wiley & Sons. Liu, Y., Wang, Y., Peng, J., Du, Y., Liu, X., Li, S., & Zhang, D. (2015). Correlations between urbanization and vegetation degradation across the world’s metropolises using DMSP/OLS nighttime light data. Remote Sensing, 7(2), pp. 2067-2088. López, E., Bocco, G., Mendoza, M., & Duhau, E. (2001). Predicting land-cover and land-use change in the urban fringe: a case in Morelia city, Mexico. Landscape and urban planning, 55(4), pp. 271-285. Luo, M., & Lau, N.-C. (2017). Heat waves in southern China: Synoptic behavior, long-term change, and urbanization effects. Journal of Climate, 30(2), pp. 703-720. Mahboob, M. A., Atif, I., & Iqbal, J. (2015). Remote sensing and GIS applications for assessment of urban sprawl in Karachi, Pakistan. Science, Technology and Development, 34(3), pp. 179-188. Mallinis, G., Koutsias, N., Tsakiri-Strati, M., & Karteris, M. (2008). Object-based classification using Quickbird imagery for delineating forest vegetation polygons in a Mediterranean test site. ISPRS Journal of Photogrammetry and Remote Sensing, 63(2), pp. 237-250. Mas, J.-F., Velázquez, A., Díaz-Gallegos, J. R., Mayorga-Saucedo, R., Alcántara, C., Bocco, G., . . . Pérez-Vega, A. (2004). Assessing land use/cover changes: a nationwide multidate spatial database for Mexico. International Journal of Applied Earth Observation and Geoinformation, 5(4), pp. 249-261. Mathew, A., Chaudhary, R., Gupta, N., Khandelwal, S., & Kaul, N. (2015). Study of Urban Heat Island Effect on Ahmedabad City and Its Relationship with Urbanization and Vegetation Parameters. International Journal of Computer & Mathematical Science, 4, pp. 2347-2357. Megahed, Y., Cabral, P., Silva, J., & Caetano, M. (2015). Land cover mapping analysis and urban growth modelling using remote sensing techniques in greater Cairo region—Egypt. ISPRS International Journal of Geo-Information, 4(3), pp. 1750-1769. Metternicht, G. (2001). Assessing temporal and spatial changes of salinity using fuzzy logic, remote sensing and GIS. Foundations of an expert system. Ecological modelling, 144(2-3), pp. 163-179. Miller, R. B., & Small, C. (2003). Cities from space: potential applications of remote sensing in urban environmental research and policy. Environmental Science & Policy, 6(2), pp. 129-137. Mirzaei, P. A. (2015). Recent challenges in modeling of urban heat island. Sustainable Cities and Society, 19, pp. 200-206. Mohammed, I., Aboh, H., & Emenike, E. (2007). A regional geoelectric investigation for groundwater exploration in Minna area, north west Nigeria. Science World Journal, 2(4) Morenikeji, G., Umaru, E., Liman, S., & Ajagbe, M. (2015). Application of Remote Sensing and Geographic Information System in Monitoring the Dynamics of Landuse in Minna, Nigeria. International Journal of Academic Research in Business and Social Sciences, 5(6), pp. 320-337. Mukherjee, A. B., Krishna, A. P., & Patel, N. (2018). Application of Remote Sensing Technology, GIS and AHP-TOPSIS Model to Quantify Urban Landscape Vulnerability to Land Use Transformation Information and Communication Technology for Sustainable Development (pp. 31-40): Springer. Myint, S. W., Gober, P., Brazel, A., Grossman-Clarke, S., & Weng, Q. (2011). Per-pixel vs. object-based classification of urban land cover extraction using high spatial resolution imagery. Remote Sensing of Environment, 115(5), pp. 1145-1161. Nemmour, H., & Chibani, Y. (2006). Multiple support vector machines for land cover change detection: An application for mapping urban extensions. ISPRS Journal of Photogrammetry and Remote Sensing, 61(2), pp. 125-133. Niu, X., & Ban, Y. (2013). Multi-temporal RADARSAT-2 polarimetric SAR data for urban land-cover classification using an object-based support vector machine and a rule-based approach. International journal of remote sensing, 34(1), pp. 1-26. Nogueira, K., Penatti, O. A., & dos Santos, J. A. (2017). Towards better exploiting convolutional neural networks for remote sensing scene classification. Pattern Recognition, 61, pp. 539-556. Oguz, H., & Zengin, M. (2011). Analyzing land use/land cover change using remote sensing data and landscape structure metrics: a case study of Erzurum, Turkey. Fresenius Environmental Bulletin, 20(12), pp. 3258-3269. Pohl, C., & Van Genderen, J. L. (1998). Review article multisensor image fusion in remote sensing: concepts, methods and applications. International journal of remote sensing, 19(5), pp. 823-854. Price, O., & Bradstock, R. (2014). Countervailing effects of urbanization and vegetation extent on fire frequency on the Wildland Urban Interface: Disentangling fuel and ignition effects. Landscape and urban planning, 130, pp. 81-88. Prosdocimi, I., Kjeldsen, T., & Miller, J. (2015). Detection and attribution of urbanization effect on flood extremes using nonstationary flood‐frequency models. Water resources research, 51(6), pp. 4244-4262. Rawat, J., & Kumar, M. (2015). Monitoring land use/cover change using remote sensing and GIS techniques: A case study of Hawalbagh block, district Almora, Uttarakhand, India. The Egyptian Journal of Remote Sensing and Space Science, 18(1), pp. 77-84. Rokni, K., Ahmad, A., Solaimani, K., & Hazini, S. (2015). A new approach for surface water change detection: Integration of pixel level image fusion and image classification techniques. International Journal of Applied Earth Observation and Geoinformation, 34, pp. 226-234. Sakieh, Y., Amiri, B. J., Danekar, A., Feghhi, J., & Dezhkam, S. (2015). Simulating urban expansion and scenario prediction using a cellular automata urban growth model, SLEUTH, through a case study of Karaj City, Iran. Journal of Housing and the Built Environment, 30(4), pp. 591-611. Santra, A. (2016). Land Surface Temperature Estimation and Urban Heat Island Detection: A Remote Sensing Perspective. Remote Sensing Techniques and GIS Applications in Earth and Environmental Studies, p 16. Shrivastava, L., & Nag, S. (2017). MONITORING OF LAND USE/LAND COVER CHANGE USING GIS AND REMOTE SENSING TECHNIQUES: A CASE STUDY OF SAGAR RIVER WATERSHED, TRIBUTARY OF WAINGANGA RIVER OF MADHYA PRADESH, INDIA. Shuaibu, M., & Sulaiman, I. (2012). Application of remote sensing and GIS in land cover change detection in Mubi, Adamawa State, Nigeria. J Technol Educ Res, 5, pp. 43-55. Song, B., Li, J., Dalla Mura, M., Li, P., Plaza, A., Bioucas-Dias, J. M., . . . Chanussot, J. (2014). Remotely sensed image classification using sparse representations of morphological attribute profiles. IEEE transactions on geoscience and remote sensing, 52(8), pp. 5122-5136. Song, X.-P., Sexton, J. O., Huang, C., Channan, S., & Townshend, J. R. (2016). Characterizing the magnitude, timing and duration of urban growth from time series of Landsat-based estimates of impervious cover. Remote Sensing of Environment, 175, pp. 1-13. Tayyebi, A., Shafizadeh-Moghadam, H., & Tayyebi, A. H. (2018). Analyzing long-term spatio-temporal patterns of land surface temperature in response to rapid urbanization in the mega-city of Tehran. Land Use Policy, 71, pp. 459-469. Teodoro, A. C., Gutierres, F., Gomes, P., & Rocha, J. (2018). Remote Sensing Data and Image Classification Algorithms in the Identification of Beach Patterns Beach Management Tools-Concepts, Methodologies and Case Studies (pp. 579-587): Springer. Toth, C., & Jóźków, G. (2016). Remote sensing platforms and sensors: A survey. ISPRS Journal of Photogrammetry and Remote Sensing, 115, pp. 22-36. Tuholske, C., Tane, Z., López-Carr, D., Roberts, D., & Cassels, S. (2017). Thirty years of land use/cover change in the Caribbean: Assessing the relationship between urbanization and mangrove loss in Roatán, Honduras. Applied Geography, 88, pp. 84-93. Tuia, D., Flamary, R., & Courty, N. (2015). Multiclass feature learning for hyperspectral image classification: Sparse and hierarchical solutions. ISPRS Journal of Photogrammetry and Remote Sensing, 105, pp. 272-285. Tzotsos, A., & Argialas, D. (2008). Support vector machine classification for object-based image analysis Object-Based Image Analysis (pp. 663-677): Springer. Wang, L., Sousa, W., & Gong, P. (2004). Integration of object-based and pixel-based classification for mapping mangroves with IKONOS imagery. International journal of remote sensing, 25(24), pp. 5655-5668. Wang, Q., Zeng, Y.-e., & Wu, B.-w. (2016). Exploring the relationship between urbanization, energy consumption, and CO2 emissions in different provinces of China. Renewable and Sustainable Energy Reviews, 54, pp. 1563-1579. Wang, S., Ma, H., & Zhao, Y. (2014). Exploring the relationship between urbanization and the eco-environment—A case study of Beijing–Tianjin–Hebei region. Ecological Indicators, 45, pp. 171-183. Weitkamp, C. (2006). Lidar: range-resolved optical remote sensing of the atmosphere: Springer Science & Business. Wellmann, T., Haase, D., Knapp, S., Salbach, C., Selsam, P., & Lausch, A. (2018). Urban land use intensity assessment: The potential of spatio-temporal spectral traits with remote sensing. Ecological Indicators, 85, pp. 190-203. Whiteside, T. G., Boggs, G. S., & Maier, S. W. (2011). Comparing object-based and pixel-based classifications for mapping savannas. International Journal of Applied Earth Observation and Geoinformation, 13(6), pp. 884-893. Willhauck, G., Schneider, T., De Kok, R., & Ammer, U. (2000). Comparison of object oriented classification techniques and standard image analysis for the use of change detection between SPOT multispectral satellite images and aerial photos. Proceedings of XIX ISPRS congress. Winker, D. M., Vaughan, M. A., Omar, A., Hu, Y., Powell, K. A., Liu, Z., . . . Young, S. A. (2009). Overview of the CALIPSO mission and CALIOP data processing algorithms. Journal of Atmospheric and Oceanic Technology, 26(11), pp. 2310-2323. Yengoh, G. T., Dent, D., Olsson, L., Tengberg, A. E., & Tucker III, C. J. (2015). Use of the Normalized Difference Vegetation Index (NDVI) to Assess Land Degradation at Multiple Scales: Current Status, Future Trends, and Practical Considerations: Springer. Yu, Q., Gong, P., Clinton, N., Biging, G., Kelly, M., & Schirokauer, D. (2006). Object-based detailed vegetation classification with airborne high spatial resolution remote sensing imagery. Photogrammetric Engineering & Remote Sensing, 72(7), pp. 799-811. Zhou, D., Zhao, S., Zhang, L., & Liu, S. (2016). Remotely sensed assessment of urbanization effects on vegetation phenology in China's 32 major cities. Remote Sensing of Environment, 176, pp. 272-281. Zhu, Z., Fu, Y., Woodco*ck, C. E., Olofsson, P., Vogelmann, J. E., Holden, C., . . . Yu, Y. (2016). Including land cover change in analysis of greenness trends using all available Landsat 5, 7, and 8 images: A case study from Guangzhou, China (2000–2014). Remote Sensing of Environment, 185, pp. 243-257.

APA, Harvard, Vancouver, ISO, and other styles

Abstract:

BackgroundPaucity of T cells in the immune privileged tumor microenvironment (TME) of pancreatic ductal adenocarcinoma (PDAC) is a major reason that PDAC is refractory to immune checkpoint blockade.1 In this study, we show that human PDAC tumors over-express vasoactive intestinal peptide (VIP), an immunosuppressive neuropeptide, that inhibits effector T cell responses and regulates chemokine receptor expression on activated T cells.2 3 We thus hypothesized that pharmacological inhibition of VIP receptor signaling could enhance anti-tumor responses in PDAC.MethodsVIP levels in plasma were determined via VIP-specific enzyme immunoassay and confirmed with immunohistochemistry (IHC) of tissue sections. VIP receptor (VIP-R) signaling in C57BL/6 immunocompetent murine models of KPC, MT5 or Panc02 pancreatic cancer was inhibited by daily sub-cutaneous treatment with ANT008 or ANT308, two novel VIP-R antagonists with predicted high binding affinities to VIP receptors.4–7 Multiplex IHC or flow cytometry detected frequencies and phenotypes of intra-tumoral T cells across treatment groups.ResultsHuman PDAC tumors expressed VIP by immunohistochemistry, and PDAC patients had significantly elevated plasma VIP levels when compared to healthy volunteers (p<0.01, figure 1). Inhibiting VIP-R signaling in combination with anti-PD-1 monoclonal antibody (MoAb) synergistically enhanced T-cell dependent anti-tumor responses in murine PDAC resulting in elimination of tumors in up to 30% of the animals and increased intratumoral CD4+ or CD8+ T cell density in orthotopic murine PDAC (figure 2). VIP-R antagonist+anti-PD-1 combination therapy significantly increased intratumoral T cell activation and the proportion of tumor specific CD8+ T cells when compared to control (p<0.01, figure 3–5). Furthermore, tumor-free mice that had been treated with VIP-R antagonist and anti-PD-1 MoAb remained tumor-free upon tumor rechallenge, indicating that combination treatment induced robust immunological memory. Interestingly, anti-PD-1 monotherapy increased expression of CXCR4 on T cells in tumor draining lymph nodes, a chemokine receptor that has been shown to trap T cells in the extracellular tumor matrix. On the other hand, combination therapy with VIP-R antagonists and anti-PD1 MoAb significantly decreased CXCR4 expression and promoted homing of adoptively-transferred GFP+ T cells into the tumors.ConclusionsVIP-R antagonists represent a novel approach to treat PDAC. VIP and VIP-R sequences are highly conserved between humans and mice,8 and human T cells are activated in vitro following treatment with VIP-R antagonists. Thus, we predict comparable anti-tumor activity of the combination of VIP-R antagonist and anti-PD-1 MoAb in human PDAC patients. Further clinical development of this novel concept will require appropriate pre-clinical pharmaco*kinetic and toxicology studies.AcknowledgementsThe authors thank healthy volunteers and patients for blood and/or tissue samples. The authors also thank the shared resources at Emory University, namely the Emory Integrated Genomics Core (EIGC), Emory Flow Cytometry Core (EFCC), Cancer Animal Models Shared Resource (CAMS), Cancer Tissue Pathology Core (CTP), Biostatistics Shared Resource (BSR) and Integrated Cellular Imaging Core (ICI), that provided services or instruments at subsidized cost to conduct some of the reported experiments. BioRender was used to make figure 4A and 5C. This work was supported in part by Katz Foundation funding and Emory School of Medicine Dean's Imagine, Innovate and Impact (I3) venture award to Edmund K. Waller and NIH R01 CA207619 awarded to Susan N. Thomas. Part of the cost for the immunohistochemistry staining of tissues was covered by Winship Cancer Institute Development Discovery and Therapeutic Program Pilot funding to Sruthi Ravindranathan.Abstract 748 Figure 1VIP is over-expressed by PDAC. (A) VIP mRNA expression levels in various solid malignancies, as obtained from TCGA. (B) Representative images of human PDAC tumor stained with antibodies to VIP or CK19, showing VIP co-expression in islets (black arrow) and cancer epithelial cells (red arrow). Levels of VIP in (C) culture supernatants collected from murine and human PDAC cell lines cultured for 24 hours (n=3 per cell line) were compared to culture supernatants from B16F10 and D4M melanoma cells; (D) plasma of mice bearing melanoma or PDAC tumors (n=5) compared to plasma of non-tumor-bearing mice; (E) plasma of PDAC patients (n=19) compared to that from healthy volunteers (n=26). Statistical differences in C and D were performed by ANOVA followed by Dunnett's post-test and in E were performed by student's t-test. Error bars show mean ± SEM. *p<0.05, **<0.01, ***p<0.001 and ****p<0.0001.Abstract 748 Figure 2VIP-R antagonists improve responses to anti-PD-1. KPC.Luc, MT5 or Panc02 cells were subcutaneously implanted in immunocompetent C57BL/6 mice. About one week after tumor implantation, when the tumors were palpable, mice were randomized into treatment groups and treated with VIP-R antagonist and/or anti-PD-1 as described in methods. (A) KPC.Luc, MT5 and Panc02 tumor volumes as measured by Vernier calipers on day 22 after subcutaneous tumor implantation. (B) Kaplan-Meier survival plots of C57BL/6 mice with subcutaneously implanted KPC.Luc, MT5 or Panc02 tumors stratified by treatment. Kaplan-Meier survival plots of (C) C57BL/6 mice receiving monoclonal CD4 and/or CD8 monoclonal antibodies (D) CD4KO or (E) CD8KO mice compared to wild-type CD57BL/6 mice with subcutaneously implanted KPC.Luc tumors, stratified by treatment. Statistical differences in A were calculated by ANOVA followed by Dunnett's post-test. Solid line shows mean with in each treatment group. Statistical differences in B-E are calculated via Log-rank test. *p<0.05, **p<0.01 and ***p<0.001, ****p<0.0001.Abstract 748 Figure 3Enhanced T cell response with combination therapy. mRNA expression in T cells isolated from subcutaneous KPC.Luc tumors in C57BL/6 mice treated with ANT008 and/or anti-PD-1 (n=3 per treatment group), were analyzed via Nanostring metabolism panel. Volcano plot showing differential expression of genes in T cells from (A) ANT008+ isotype IgG (IgG) vs scrambled peptide (Scram) + isotype IgG, (B) scrambled peptide +anti-PD-1 vs scrambled peptide + isotype IgG and (C) ANT008+anti-PD-1 vs scrambled peptide + isotype IgG (n=3 mice per treatment group). Genes that are associated with TCR activation and co-stimulation and are at levels significantly higher when compared to Scram+ isotype IgG (FDR<0.1) are labeled in red. (D) Heat map showing gene expression changes in genes associated with TCR activation and co-stimulation. (E) TCR activation and co-stimulation pathway score between the T cells in tumors of mice from the different treatment groups. (F) CD8+ T cells in subcutaneous KPC.Luc tumors were stained with MuLV p15E-H2Kb tetramer after 10 days of treatment with ANT308 and/or anti-PD-1 (n=3 per treatment group) and analyzed via flow cytometry for percentage of tetramer+ CD8+ T cells. (G) Kaplan-Meier survival curves of subcutaneous KPC.Luc bearing mice treated with ANT008 and/or anti-PD-1 from day 3–12 after tumor implantation (n=3 per scrambled peptide + isotype IgG, ANT008+ isotype IgG and scrambled peptide + anti-PD-1 treatment groups; n=8 in ANT008 + anti-PD-1 treatment group). (H) Kaplan-Meier survival curves of tumor free mice from G that were re-challenged with KPC.Luc tumors on the opposite flank (n=3 per scrambled peptide + isotype IgG and scrambled peptide + anti-PD-1 treatment group; n=5 in ANT008+anti-PD-1 treatment group). Statistical differences in E and F were calculated via ANOVA followed by Dunnett's post-test and in G and H were calculated using Log-rank test. Error bars show mean ± SEM *p<0.05, **p<0.001, ***p<0.0001.Abstract 748 Figure 4Increased T cell density with combination therapy. KPC.Luc cells were orthotopically implanted in the tail of the pancreas of C57BL/6 mice and treated with ANT008 and/or anti-PD-1 with n=9, 10, 8 and 11 in scrambled+IgG, ANT008+IgG, scrambled+anti-PD-1 and ANT008+anti-PD-1, respectively. (A) Schematic showing orthotopic implantation of KPC.Luc cells and treatment strategy with ANT008 and/or anti-PD-1. (B) Waterfall plot showing % change in tumor flux on day 22 relative to day 7 prior to start of treatment. (C) Total flux as measured by IVIS bioluminescent imaging in the different treatment groups. Cross symbol represents mice that were euthanized before day 25 due to ulceration of the tumor and circle symbol represent mouse that were imaged on day 26 via MRI imaging shown in supplementary figure S5. (D) Bar graph showing weight of pancreas on day 25 when the mice were euthanized. 'Star' shaped data points indicate tumor free mice and dotted horizontal line represents the average weight of healthy pancreas from naïve mice. (E) Representative multiplex IHC images (right) showing pancreatic tumors stained for DAPI (blue), CD4 (yellow), CD8 (red) and Ki67 (cyan) and trichrome staining (left) with black arrows showing blue collagen stain in the tissue. XY plot showing the correlation between number of (F) CD4+ or (G) CD8+ T cells/mm2; and (H) Ki67+ CD4+ or (I) Ki67+ CD8+ T cells/mm2 with weight of the pancreas with n=4 to 6 mice per group. P values in panel D were calculated using student ANOVA followed by Dunnett's post hoc test (comparing each treatment group with Scram+IgG). Error bars show mean ± SEM. *p<0.05, **p<0.01.Abstract 748 Figure 5Increased T cell homing with combination therapy. KPC.Luc tumors were subcutaneously implanted in C57BL/6 mice and treated with VIP-R antagonist and/or anti-PD-1 checkpoint therapy for 10 days after the tumors were palpable. Tumor draining lymph nodes were then analyzed for percentage of (A) CXCR4+CD69+ and (B) CXCR4+Ki67+ cells in CD4+ (left) and CD8+ (right) subsets of T cells. In a separate experiment, on day 15 after subcutaneous implantation of KPC.Luc tumors, GFP+ T cells from enhanced GFP transgenic mice (C57BL/6 background) were adoptively transferred (via tail vein injections) and treated with ANT308± aPD-1 for 3 days. (C) Schematic showing GFP+ T cell transfer and treatment strategy in mice with subcutaneous KPC.Luc tumors. (D) Representative Hoescht (blue for nucleus) stained tumor tissues from tumors of each treatment group. Two regions of interest (ROI) in ANT308+aPD-1 treated tumors are shown at higher magnification. Statistical differences in A and B were determined via repeated measures ANOVA and Dunnett's post-test with n=4–5 mice per group. *p<0.05, **p<0.01, **p<0.001, p<0.0001.ReferencesSahin IH, et al. Immunotherapy in pancreatic ductal adenocarcinoma: an emerging entity? Ann Oncol 2017;28(12):2950–2961.Gonzalez-Rey E, Anderson P, Delgado M. Emerging roles of vasoactive intestinal peptide: a new approach for autoimmune therapy. Ann Rheum Dis 2007;66(Suppl 3):p. iii70–6.Anderson P, Gonzalez-Rey E. Vasoactive intestinal peptide induces cell cycle arrest and regulatory functions in human T cells at multiple levels. Mol Cell Biol 2010;30(10):2537–51.Li JM, et al. VIPhyb, an antagonist of vasoactive intestinal peptide receptor, enhances cellular antiviral immunity in murine cytomegalovirus infected mice. PLoS One 2013;8(5):e63381.Moody TW, et al., VIP receptor antagonists and chemotherapeutic drugs inhibit the growth of breast cancer cells. Breast Cancer Res Treat 2001;68(1):55–64.Moody TW, et al. A vasoactive-Intestinal-Peptide antagonist inhibits nonsmall cell lung-cancer growth. Proceedings of the National Academy of Sciences of the United States of America 1993;90(10):4345–4349.Zia H, et al. Breast cancer growth is inhibited by vasoactive intestinal peptide (VIP) hybrid, a synthetic VIP receptor antagonist. Cancer Res 1996;56(15):3486–9.Sena M, et al. High conservation of upstream regulatory sequences on the human and mouse vasoactive intestinal peptide (VIP) genes. DNA Seq 1994;5(1):25–9.Ethics ApprovalAll experimental procedures involving mice were approved by the Institutional Animal Care and Use Committee (IACUC) at Emory University. De-identified blood samples from consented patients with PDAC (IRB 00087397) or healthy volunteers (IRB 00046063) were obtained with approval from Institutional Review Boards.

APA, Harvard, Vancouver, ISO, and other styles

Abstract:

The emphasis of this article lies on the properties of heavy fermion systems at the lowest temperatures obtained so far. Methods for measuring specific heat capacity and magnetic susceptibility in the milliKelvin regime are described for both low magnetic fields (<20 mT ) and high fields (<8 T ). Experimental results on UPt 3, UBe 13, and CeCu 6, are presented, and remaining problems are discussed. UPt 3 is widely regarded as the heavy Fermion system which exhibits unconventional superconductivity as demonstrated by the existence of multiple superconducting phases. Whether power laws for instance for the specific heat capacity in the superconducting state extend to T ≈ 0 instead of an exponential behavior as for BCS superconductors is a long-standing question. We have measured the specific heat capacity of several single crystals of UPt 3 in magnetic fields varying from 0 up to 7 T down to a final temperature of 10 mK . Instead of an extended power law a maximum of c(T) occurs around 20 mK, and this maximum persists in magnetic fields above B c2. It is obviously due to a new phase transition which is present both in the normal and in the superconducting state of UPt 3, slightly modified in the latter. Entropy balance above T c is fulfilled if the low-temperature peaks are included. DC-magnetization measurements on two single crystals of UPt 3 in a SQUID system yield a temperature dependence of the penetration depth ~T2 between 150 and 20 mK, considerably extending the temperature range of earlier experiments. Measurements of the anisotropic part of the magnetic susceptibility in a torque-meter indicate an additional phase line from a temperature-dependent anisotropic susceptibility to a T-independent state which is closely connected to the Bc2-line over a wide field range. No indication for a re-entrance of superconductivity is found down to 20 mK. For UBe 13 (in the superconducting state) no specific heat anomaly above 24 mK is found but a deviation from the T2.7 power law valid at higher temperatures. On a single crystal of CeCu 6 dc-magnetization measurements in various magnetic fields in a SQUID system show a plateau of the magnetic susceptibility between 400 and 50 mK, followed by an increase towards lower temperatures. An attempt to fit the low-temperature magnetization curves in several fields between 0.01 mT and 1.6 mT (minus the background from the plateau) with a Brillouin function revealed significant deviations. In 2.7 mT, the highest field applied in this experiment, however, the magnetization can be perfectly fitted assuming a tiny concentration of Gd impurities (1.5 ppm). After subtraction of the contribution due to the Gd 3+ ions from the magnetization curves in each of the lower fields a drop is revealed below 3–5 mK which gets successively quenched by the magnetic field and which has disappeared in 2.7 mT. The specific heat capacity of the same single crystal of CeCu 6 in zero magnetic field shows an increase of c/T from 1.55 J/moleK 2 at higher temperatures up to 2.8 J/moleK 2 at 11 mK. We interpret both results as due to an antiferromagnetic phase transition at 3–5 mK with the peak just not reached in the specific heat experiments.

APA, Harvard, Vancouver, ISO, and other styles

Abstract:

Industrial compost piles contain large volumes of bulk organic materials. Normally, there are two main heat generation processes—oxidation of cellulosic materials and biological activity within the compost pile. Biological heating occurs at a lower temperature range, but it may `kick-start' the oxidation reaction. Nevertheless, biological heating is desirable and is a key component in composting operations. However, there are cases when the temperature within the compost piles increases beyond the ignition temperature of cellulosic materials which can result in spontaneous ignition. This investigation considers the self-heating process that occurs in a compost pile using a two-dimensional spatially-dependent model incorporating terms that account for self-heating due to both biological and oxidative mechanisms. The variation of temperature distribution within different pile geometries is examined. References P. C. Bowes. Self heating: evaluating and controlling the hazard. Amsterdam: Elsevier Press, 1984 W. F. Brinton, Jr. E. Evans, M. L. Droffner, and R. B. Brinton. Standardized test for evaluation of compost self-heating. BioCycle 36 (1995), pp. 60–65 M. Escudey, A. Arias, J. Forster, N. Moraga, C. Zambra, and A. C. Chang. Sewage sludge self-heating and spontaneous combustion. Field, laboratory and numerical studies. High Temp. Mater. Proc. 27.5 (2008), pp. 337–346. doi: 10.1515/HTMP.2008.27.5.337 R. T. Haug. The Practical Handbook of Compost Engineering. USA: Lewis Publishers, 1993. doi: 10.1201/9780203736234 W. Hogland, T. Bramryd, and I. Persson. Physical, biological and chemical effects of unsorted fractions of industrial solid waste in waste fuel storage. Waste Manage. Res. 14.2 (1996), pp. 197–210. doi: 10.1006/wmre.1996.0019 P. F. Hudak. Spontaneous combustion of shale spoils at sanitary landfill. Waste Manage. Res. 22.6 (2002), pp. 687–688. doi: 10.1016/s0956-053x(01)00077-0 F. Kuwahara, Y. Sano, A. Nakayama, K. Nakasaki, and T. f*ckazawa. Numerical modelling of a composting process with aeration. J. Porous Media 12.10 (2009), pp. 927–938. doi: 10.1615/JPorMedia.v12.i10.10 T. Luangwilai and H. S. Sidhu. Determining critical conditions for two dimensional compost piles with air flow via numerical simulations. Proceedings of the 15th Biennial Computational Techniques and Applications Conference, CTAC-2010. Ed. by W. McLean and A. J. Roberts. Vol. 52. ANZIAM J. 2011, pp. C463–C481. doi: 10.21914/anziamj.v52i0.3753 T. Luangwilai, H. S. Sidhu, and M. I. Nelson. A two dimensional, reaction-diffusion model of compost piles. Proceedings of the 10th Biennial Engineering Mathematics and Applications Conference, EMAC-2011. Ed. by M. Nelson, M. Coupland, H. Sidhu, T. Hamilton, and A. J. Roberts. Vol. 53. ANZIAM J. 2012, pp. C34–C52. doi: 10.21914/anziamj.v53i0.5083 T. Luangwilai, H. S. Sidhu, and M. I. Nelson. One-dimensional spatial model for self-heating in compost piles: Investigating effects of moisture and air flow. Food Bioprod. Process. 108 (2018), pp. 18–26. doi: 10.1016/j.fbp.2017.12.001 T. Luangwilai, H. S. Sidhu, and M. I. Nelson. Understanding effects of ambient humidity on self-heating of compost piles. CHEMECA 2018. Institution of Chemical Engineers. 2018, p. 68. url: https://search.informit.org/doi/10.3316/informit.049196748938234 T. Luangwilai, H. S. Sidhu, and M. I. Nelson. Understanding the role of moisture in the self-heating process of compost piles. CHEMECA 2012. Engineers Australia. 2012, pp. 1834–1846. url: https://search.informit.org/doi/10.3316/INFORMIT.867764346204981 T. Luangwilai, H. S. Sidhu, M. I. Nelson, and X. D. Chen. Biological self-heating of compost piles with airflow. CHEMECA 2009. Engineers Australia. 2009, pp. 2683–2692. url: https://search.informit.org/doi/10.3316/informit.799299549211365 T. Luangwilai, H. S. Sidhu, M. I. Nelson, and X. D. Chen. Modelling air flow and ambient temperature effects on the biological self-heating of compost piles. Asia-Pacific J. Chem. Eng. 5.4 (2010), pp. 609–618. doi: 10.1002/apj.438 T. Luangwilai, H. S. Sidhu, M. I. Nelson, and X. D. Chen. Modelling the effects of air flow, ambient temperature and radiative boundary conditions in compost piles. CHEMECA 2010. Engineers Australia. 2010, pp. 3585–3596. url: https://search.informit.org/doi/10.3316/informit.484992904303574 T. Luangwilai, H. S. Sidhu, M. I. Nelson, and X. D. Chen. Modelling the effects of moisture content in compost piles. CHEMECA 2011. Engineers Australia. 2011, pp. 1473–1484. url: https://search.informit.org/doi/10.3316/informit.174710980721893 T. Luangwilai, S. D. Watt, S. Fu, H. S. Sidhu, and M. I. Nelson. Modelling the effects of ambient temperature variation on self-heating process of compost piles. Engineers Australia (2019), pp. 84–96. url: https://search.informit.org/doi/10.3316/informit.689351109484953 N. O. Moraga, F. Corvalan, M. Escudey, A. Arias, and C. E. Zambra. Unsteady 2D coupled heat and mass transfer in porous media with biological and chemical heat generations. Int. J. Heat Mass Trans. 52 (2009), pp. 5841–5848. doi: 10.1016/j.ijheatmasstransfer.2009.07.027 PDE Solutions Inc. FlexPDE v 6.05. PDE Solutions Inc. Cambridge MA, 2009. url: http://www.pdesolutions.com R. Rynk. Fires at composting facilities: causes and conditions Part I. BioCycle 41.1 (2000), pp. 54–58 H. S. Sidhu, M. I. Nelson, and X. D. Chen. A simple spatial model for self-heating compost piles. Proceedings of the 13th Biennial Computational Techniques and Applications Conference, CTAC-2006. Ed. by W. Read and A. J. Roberts. Vol. 48. ANZIAM J. 2007, pp. C135–C150. doi: 10.21914/anziamj.v48i0.86

APA, Harvard, Vancouver, ISO, and other styles

Abstract:

Introduction Systematic assessment of load and recovery in athletes is essential for effectively adjusting various training demands and their corresponding recovery measures (Kellmann et al., 2018), thereby reducing the risk of nonfunctional overreaching, overtraining, and potential subsequent injuries and illnesses (Bourdon et al., 2017; Kellmann et al., 2018; Taylor et al., 2012). The information obtained from the assessment can support athletes, coaching staff, and their medical teams in the tightrope act between performance optimisation and injury risk reduction. The expert consensus in the field of load and recovery monitoring and other research emphasises the importance of employing a multivariate approach for assessing load and recovery (Bourdon et al., 2017; Kellmann et al., 2018). Various physiological and psychological measures should be used for this purpose (Heidari et al., 2019). In team sports, it is also required that these assessments be carried out quickly, non-invasively, and with minimal added burden on the athletes (Thorpe et al., 2017). In this research project, we developed a web application-based Load and Recovery Score (LRS) and evaluated its relationship with established load parameters. It is assumed that specific training and match load variables correlate negatively with the following day’s LRS when controlled for intra-subject variability. Methods 78 female and male athletes from the U18, U19 and U21 teams of the Swiss soccer club “BSC Young Boys” were selectively recruited. 71 players (32.4% female) with an average age of 17.9 years (SD = 1.2) were monitored over a minimum period of 35 days. A repeated-measure design by means of a five-to-seven-week prospective longitudinal data collection was used in this study. The dependent variable (LRS) and four other independent load variables were repeatedly measured over time in the same athletes. The LRS comprises eight subscales integrated into an interval-scaled score ranging from 0 to 120. A higher score indicates a better recovery state and lower loads. The players recorded values for these eight different subscales daily using the web application. The subscales include questions drawn from various previously validated questionnaires related to the player’s 1) Physical capability, 2) General state of regeneration, 3) Muscular stress, 4) Fatigue, 5) Mood, and 6) Sleep quality, contributing to the recovery component of the score. Additionally, there are two load subscales pertaining to the player’s 7) Heart Rate Variability (HRV) and their 8) Acute:Chronic Workload Ratio (ACWR). The entries are either directly recorded on an ordinal scale (0-6) or are converted to conform to this scale level. Daily logs are incorporated into the different subscale values using a specific algorithm. The algorithm is informed by current research recommendations and is a proprietary business secret. The independent variables included the subjective Player- and Trainer – Session Rating of Perceived Exertion (PSRPE/TSRPE), as well as two GPS and accelerometry-based parameters: Total distance covered (TD) and Total distance > 20km/h (TD20). To examine direction and strength of the relationship between the LRS and the above-mentioned measures of training and match load, various linear mixed-effects models (LMM) were fitted via restricted maximum likelihood (REML). Random intercepts were defined for each player to account for the repeated within-subject measurements (Fisher et al., 2018; Molenaar & Campbell, 2009; Neumann et al., 2021), and the demographic control variables Height, Body mass and Sex were included in the models. Furthermore, the variance explained by the random effects was calculated using Nakagawa’s marginal and conditional R2 for mixed models. Results All training and match load parameters demonstrated significant negative correlations with the subsequent day’s LRS. In the linear mixed-effects model analysis PSRPE and TSRPE showed similar fixed effects (-0.013, 95% CI [-0.017, -0.010], p < .001 versus -0.008, 95% CI [-0.011, -0.006], p < .001), while TD exhibited stronger associations (-0.668, 95% CI [-0.979, -0.355], p < .001) than TD20 (-0.009, 95% CI [-0.012, -0.006], p < .001). The addition of control variables did not significantly influence direction or magnitude of the model’s effects. Variance explained by the residual factor ID (defining each individual) was high (≥ 0.444) in all of the analyses and post-hoc analyses on the influence of the variables Playing position and Sex showed high variation between these subgroups. Discussion/Conclusion The results show that the LRS has significant negative associations when controlled for repeated within-subject measurements with different subjective and objective training and match load measures, such as the PSRPE, the TSRPE, TD, and TD20. Therefore, it can track the effect of those variables whilst also being an indicator of different recovery parameters. All training and match load variables behave according to the a priori assumption and correlate negatively with the following day’s LRS. This is in line with the available literature, where it has already been shown that certain parameters, which are also part of the score, show good moderate to strong evidence for associations with different load indicators. The fact that the variance explained by the residual factor ID and the influence of grouping variables (Playing position/Sex) was high in all the analyses is consistent with current research (Hader et al., 2019; Neumann et al., 2021), where the impact of the different load parameters on recovery varied across groups and individuals. No single marker can provide global information (Temm et al., 2022) regarding an athlete’s recovery. The comprehensive LRS offers a solution to that problem because it can track different load parameters in elite youth soccer players and present multiple accepted recovery and load measures separately and on an individual level so that athletes, coaches and staff can use it to enhance their knowledge of responses (Bourdon et al., 2017) and determine future training and match load as well as suited means of recovery. By doing this, injury risk could be reduced and performance optimised. The ultimate decision of which monitoring tools to work with should remain with the sports professionals. It is essential that the protocol has reasonable practicability and uses an individualised (Temm et al., 2022), and multimodal approach, including biological and social aspects (Heidari et al., 2019). References Bourdon, P. C., Cardinale, M., Murray, A., Gastin, P., Kellmann, M., Varley, M. C., Gabbett, T. J., Coutts, A. J., Burgess, D. J., Gregson, W., & Cable, N. T. (2017). Monitoring athlete training loads: Consensus statement. International Journal of Sports Physiology and Performance, 12(Suppl 2), S2161–S2170. https://doi.org/10.1123/IJSPP.2017-0208 Fisher, A. J., Medaglia, J. D., & Jeronimus, B. F. (2018). Lack of group-to-individual generalizability is a threat to human subjects research. Proceedings of the National Academy of Sciences, 115(27), E6106–E6115. https://doi.org/10.1073/pnas.1711978115 Hader, K., Rumpf, M. C., Hertzog, M., Kilduff, L. P., Girard, O., & Silva, J. R. (2019). Monitoring the athlete match response: Can external load variables predict post-match acute and residual fatigue in soccer? A systematic review with meta-analysis. Sports Medicine - Open, 5(1), Article 48. https://doi.org/10.1186/s40798-019-0219-7 Heidari, J., Beckmann, J., Bertollo, M., Brink, M., Kallus, W., Robazza, C., & Kellmann, M. (2019). Multidimensional monitoring of recovery status and implications for performance. International Journal of Sports Physiology and Performance, 14(1), 2-8. https://doi.org/10.1123/ijspp.2017-0669 Kellmann, M., Bertollo, M., Bosquet, L., Brink, M., Coutts, A. J., Duffield, R., Erlacher, D., Halson, S. L., Hecksteden, A., Heidari, J., Kallus, K. W., Meeusen, R., Mujika, I., Robazza, C., Skorski, S., Venter, R., & Beckmann, J. (2018). Recovery and performance in sport: Consensus statement. International Journal of Sports Physiology and Performance, 13(2), 240–245. https://doi.org/10.1123/ijspp.2017-0759 Molenaar, P. C. M., & Campbell, C. G. (2009). The new person-specific paradigm in psychology. Current Directions in Psychological Science, 18(2), 112–117. https://doi.org/10.1111/j.1467-8721.2009.01619.x Neumann, N. D., Van Yperen, N. W., Brauers, J. J., Frencken, W., Brink, M. S., Lemmink, K. A. P. M., Meerhoff, L. A., & Den Hartigh, R. J. R. (2021). Nonergodicity in load and recovery: Group results do not generalize to individuals. International Journal of Sports Physiology and Performance, 17(3), 391–399. https://doi.org/10.1123/ijspp.2021-0126 Taylor, K.-L., Chapman, D., Cronin, J., Newton, M., & Gill, N. (2012). Fatigue monitoring in high performance sport: A survey of current trends. Journal of Australian Strength and Conditioning, 20, 12–23. Temm, D. A., Standing, R. J., & Best, R. (2022). Training, wellbeing and recovery load monitoring in female youth athletes. International Journal of Environmental Research and Public Health, 19(18), 11463. https://doi.org/10.3390/ijerph191811463 Thorpe, R. T., Atkinson, G., Drust, B., & Gregson, W. (2017). Monitoring fatigue status in elite team-sport athletes: Implications for practice. International Journal of Sports Physiology and Performance, 12(Suppl 2), S227–S234. https://doi.org/10.1123/ijspp.2016-0434

APA, Harvard, Vancouver, ISO, and other styles

Abstract:

Abstract Backgroud and objectives: The formation of antibodies (Abs) to heparin platelet factor 4 complexes (H/PF4) associated with heparin-induced thrombocytopenia (HIT) is a T-helper cell dependent event that involves antigen presenting cells (APC) and B-lymphocytes. Polymorphisms of the CTLA-4 (cytotoxic T lymphocyte antigen 4) gene have been described as a risk factor in several autoimmune diseases. In addition, TNFα is a major inflammatory cytokine with potent regulatory functions and polymorphisms in TNFA have also been associated with autoimmune antibody-mediated diseases. We therefore evaluated the possibility that an association between polymorphisms in CTLA-4 (−318 C/T and +49 A/G) or TNFA (−308 G/A) and the development of Abs to H/PF4 and HIT might exist. Methods: Eighty-three patients identified as having developed definite HIT with significant levels of Abs to PVS/PF4 in ELISA (HAT 45, GTI, Brookfield, WI, USA) and positive serotonin release assay were studied (HIT group). Two control groups were studied: the Abneg group consisted of 83 patients who had undergone heart surgery with high doses of unfractionated heparin administered during cardiopulmonary bypass (CPB), and who were tested negative for Abs to PVS/PF4 at the 8th post operative day. The Abpos group consisted of 58 patients who had also undergone CPB but had developed high levels of Abs to PVS/PF4 without significant change in the platelet count post-operatively. Three single nucleotide polymorphisms (SNPs), one in TNFA (−308G/A) and two in CTLA-4 (−318 C/T and +49A/G) were studied by conventional RFLP analysis as described (Astermark et al, Blood 2006 and Astermark et al, Thromb Haemost 2007). Results: The CTLA-4 +49 A/G and −318 C/T genotypes and allele distributions were similar in the 3 groups of patients (Table). In contrast, the frequency of TNFA –308 G/G hom*ozygotes was higher in the HIT group compared to patients without HIT whether they had developed PF4-specific Abs or not (p=0.035). Therefore, the A allele was less frequent in HIT patients (p=0.026, OR 0.49; CI95% 0.26–0.93) but there was no significant difference when comparing patients with and without PF4-dependent antibodies. Genotype Allele frequency Ab neg (n = 82) Ab pos (n = 58) HIT (n = 82) CTLA-4(+49) A/A 31 (38%) 24 (41%) 35 (43%) A/G 40 (49%) 26 (45%) 41 (50%) G/G 11 (13%) 8 (14%) 6 (7%) CTLA-4(−318) C/C 63 (77%) 49 (84%) 67 (82%) C/T 19 (23%) 9 (16%) 17 (21%) T/T 0 0 0 (0%) TNFα(−308) G/G 59 (72%) 41 (71%) 68 (84%) G/A 20 (24%) 15 (26%) 12 (15%) A/A 3 (4%) 2 (3%) 1 (1%) A Allele 0.160 0.160 0.09 G Allele 0.840 0.840 0.910 Conclusion: The TNFA –308 A allele appears to be protective regarding the risk of heparin-induced thrombocytopenia in patients having developed PF4-specific antibodies. A similar effect has been suggested in immune thrombocytopenic purpura (Foster et al, Brit J Haematol 2001) despite individuals with this allele have been identified as high TNFα producers. Therefore, the mechanisms involved for explaining this apparent protective effect of the TNFA −308A allele in patients at risk for HIT have to be identified.

APA, Harvard, Vancouver, ISO, and other styles

Abstract:

The lance nematode Hoplolaimus magnistylus Robbins 1982 (3) was found for the first time in Tennessee in a cotton (Gossypium hirsutum L.) field (35°19.550′ N, 89°24.535′ W) in Fayette County in May 2011. In June of the same year, the species was also found in soil samples collected from a corn (Zea mays L.) field (36°15.736′ N, 88°51.121′ W) and a soybean (Glycine max L.) field (36°15.616′ N, 88°51.118′ W) in Weakley County, TN. Nematodes were extracted from the soil with a semi-automatic elutriator and further processed by sugar flotation-centrifugation. Population densities were between 30 and 50 individuals per 100 cm3 of soil in areas with noticeable stunting. Helicotylenchus sp. and Pratylenchus sp. were also present at less than 10 individuals per 100 cm3 of soil. Ten soybean seeds, cv. Hutcheson, were planted and inoculated with 50 H. magnistylus per 100 cm3 in steam-sterilized soil, and were maintained in a greenhouse. Forty-five days later, soybean plants exhibited at least one of the following symptoms: stunting and chlorosis, reduced root growth, and localized root lesions. Individual nematodes were handpicked and identified under a compound light microscope as H. magnistylus based on morphological and morphometric characteristics. The main diagnostic character for this species is the size of the stylet. In the populations collected, females had stylets ranging from 49 to 58 μm (mean 56 μm). Males and females were observed with head distinctly set off and massive cephalic framework, stylet long and robust and stylet knobs pointed anteriorly. The lateral field was areolated and had four incisures most of the body length, the excretory pore was prominent and located 190 μm (175 to 200 μm) from anterior end, hemizonid was large and located one or two annules posterior to the excretory pore, phasmids were large, conspicuous, and variable in position, and vulva was prominent and near midbody. This species is most similar to the more commonly reported H. galeatus, but differs from it in the longer stylet. Total DNA was extracted from single adults from each soil sample and the species-specific primers Hoc-1f (5′-AACCTGCTGCTGGATCATTA-3′) and HM-3r (5′-AGACTGGACGGCCAAAGTT-3′) designed by Bae et al. (1) were used to confirm the identification by amplification of a distinct 340-bp amplicon that differentiates this species from H. columbus, H. galeatus, H. concaudajuvencus, and H. stephanus. H. magnistylus was first described from soil samples taken from a corn and soybean field in Marianna, AR (3), and has been reported in association with soybean and corn in Louisiana and Mississippi (4). Robbins (4) reported that H. magnistylus was not a serious pest of irrigated cotton in Arkansas, but there are no other pathogenicity studies published for soybean, corn, or non-irrigated cotton. Other lance species, mainly H. galeatus and H. columbus, have been reported to cause serious damage to cotton in the Carolinas and Georgia (3). Previously, H. galeatus was reported in Tennessee by Bernard (2). Lance nematodes feed as migratory endo- and ectoparasites and injure the growing points of roots, causing stunting of plants. Because so little is known about the pathogenicity of this nematode, it becomes relevant to add our records of its known distribution in field crops in the United States. To our knowledge, this is the first report of H. magnistylus in Tennessee. References: (1) C. H. Bae et al. Nematology 11:471, 2009. (2) E. C. Bernard. University of Tennessee Bulletin 594, 1980. (3) R. T. Robbins. J. Nematol. 14:500, 1982. (4) R. T. Robbins. J. Nematol. 30(4S):590, 1998.

APA, Harvard, Vancouver, ISO, and other styles

Abstract:

The efficacy of adeno-associated virus (AAV)-based gene therapy is dependent on effective viral transduction, which might be inhibited by preexisting immunity to AAV acquired from infection or maternal delivery. Anti-AAV neutralizing Abs (NAbs) titer is usually measured by in vitro assay and used for patient enroll; however, this assay could not evaluate NAbs’ impacts on AAV pharmacology and potential harm in vivo. Here, we infused a mouse anti-AAV9 monoclonal antibody into Balb/C mice 2 h before receiving 1.2 × 1014 or 3 × 1013 vg/kg of rAAV9-coGAA by tail vein, a drug for our ongoing clinical trials for Pompe disease. The pharmaco*kinetics, pharmacodynamics, and cellular responses combined with in vitro NAb assay validated the different impacts of preexisting NAbs at different levels in vivo. Sustained GAA expression in the heart, liver, diaphragm, and quadriceps were observed. The presence of high-level NAb, a titer about 1:1000, accelerated vector clearance in blood and completely blocked transduction. The AAV-specific T cell responses tended to increase when the titer of NAb exceeded 1:200. A low-level NAbs, near 1:100, had no effect on transduction in the heart and liver as well as cellular responses, but decreased transduction in muscles slightly. Therefore, we propose to preclude patients with NAb titers > 1:100 from rAAV9-coGAA clinical trials.

APA, Harvard, Vancouver, ISO, and other styles

Abstract:

All-solid-state batteries (ASSBs) are widely investigated in the field of lithium-ion battery (LIB) research, since they might offer several advantages over the conventional LIB technology based on liquid electrolytes, for example a possible lower flammability of solid electrolytes compared to organic solvents in LIBs.[1] However, Li6PS5Cl (LPSCl), a commonly used sulfidic solid electrolyte undergoes exothermic reactions with de-lithiated nickel-rich NCM already above 150°C.[2] Establishing a temperature window for save long-term operation is therefore required for large-scale applications in, e.g., battery electric vehicles. Additionally, a fundamental challenge for the development and electrochemical characterization of individual electrodes for ASSBs is to achieve accurate potential control of the working electrode (WE). In general, this can be done by either the use of a reference electrode (RE) or, alternatively, by the use of a counter electrode (CE) with a well-defined constant potential and little overpotential, whereby the later condition is difficult to meet at high C-rates for electrodes with industrially relevant areal capacities. Recently, we reported on a single-layer pouch cell configuration with an integrated µ-RE, which consist of a thin (~50 µm Ø) in-situ lithiated gold wire that provides a long-term stable reference potential.[3] This configuration was adapted from a µ-RE based three-electrode setup for liquid electrolyte LIBs.[4] In this study, we utilize the described setup to investigate the temperature dependent rate capability and cycling stability of ASSB cathodes, composed of a LiNi0.85Co0.10Mn0.05O2, solid electrolyte (LPSCl), conductive carbon additive, and a binder in sulfidic ASSB single-layer pouch cells at a comparatively low measurement pressure of 30 MPa. Besides the NCM WE with an application-oriented areal capacity of 3 mAh/cm2, a sulfidic solid electrolyte sheet-type separator,[5] and an InLi alloy counter electrode are used. In the cathode discharge rate tests, the upper and lower cathode cutoff potentials are controlled via the lithiated gold wire µ-RE. Stepwise increased current densities from 0.1C up to 10C (30 mA/cm²) are investigated, while the charge rate is kept constant at 0.2C (CCCV). Figure 1 exemplarily shows the discharge rate data obtained at 25°C for upper/lower cathode cutoff potentials of 2.6/4.2 V vs. Li+/Li, demonstrating a specific capacity of ~180 mAh/gCAM at 0.1C, which decreases by only ~15% when increasing the discharge rate to 1C. To the best of our knowledge, the here demonstrated rate capability is quite remarkable for cathodes with such high areal capacities. The deconvolution of the half-cell potentials shows that the InLi CE has a constant overpotential of ~400 mV at the highest here examined current density of 30 mA/cm2 (at 10C) and is therefore not interfering with the cathode discharge rate test. In our presentation we will discuss the temperature dependence of the discharge rate capability as well the temperature dependent cycling stability at a discharge rate of 1.0C, including intermittent rate tests. Acknowledgements: BASF (Ludwigshafen, Germany) is gratefully acknowledged for supplying the NCM material. Literature: [1]S. Hess, M. Wohlfahrt-Mehrens, M. Wachtler,J. Electrochem. Soc., 2015, 162 (2) A3084-A3097 [2] T. Kim, K. Kim, S. Lee, G. Song, M. S. Jung, K. T. Lee, Chem. Mater., 2022, 34, 9159−9171 [3] C. Sedlmeier, R. Schuster, C. Schramm, H.A.Gasteiger, J. Electrochem. Soc., 2023, 170, 030536 [4]S. Solchenbach, D. Pritzl, E. J. Y. Kong, J. Landesfeind, H. A. Gasteiger,J. Electrochem. Soc., 2016, 163(10) A2265-A2272 [5] C. Sedlmeier, T. Kutsch, R. Schuster, L. Hartmann, R. Bublitz, M. Tominac, M. Bohn, H. A. Gasteiger. J. Electrochem. Soc., 2022, 169, 070508 Figure 1

APA, Harvard, Vancouver, ISO, and other styles

Abstract:

Polymer electrolyte membrane fuel cells (PEMFC) are a viable alternative to combustion engines and rechargeable batteries for automotive applications. However, the operating temperature of PEMFCs using sulfonated fluoropolymers, e.g. NAFION®, is limited below 80 °C (ambient pressure), because the proton conduction relies on the presence of water. A PEMFC operating above 100 °C would allow a much more simplified system setup for water and heat management. This requires novel non-aqueous protic electrolytes. Proton conducting ionic liquids (PIL) are promising candidates. [1,2]. However, the fuel cell relevant electrode reactions—oxygen reduction and hydrogen oxidation reaction (ORR/HOR)—are not as well understood as in aqueous electrolytes. In this study, we employed electrochemical impedance spectroscopy (EIS), cyclovoltammetry (CV), chronoamperomery (CA) and steady state current measurements to elucidate the double layer properties of the platinum electrode/PIL interface, the kinetics and possible mechanism of the ORR. Three PILs with different cation acidities with an Brønsted-acidic cation [HA+][X−] are compared, [Dema][TfO], [1-EIm][TfO] and [2-Sema][TfO]. Comparing the PILs with different cation acidity strongly suggest that the first reduction step including the proton transfer to the (catalytic) active sites on the electrode is mainly determining the ORR rate. The presence of residual water, unavoidable also at fuel cell operation >100 °C, is another important parameter. H2O modifies the ordered structure of the electrochemical double layer. Its protolysis equilibrium with an acidic PIL cation results in the formation of H3O+ that serves as a proton donor in the rate determining step and thus influences the ORR kinetics. Highly acidic PIL cations serve as a proton donor as well, particularly at low H2O concentrations, whereas the role of H3O+ as proton donor in the ORR becomes more prominent at higher water concentrations [3]. In low acidic PILs, H3O+ is the predominant proton donor and the ORR rate is significantly smaller resulting in considerably higher overpotentials. Thus, the onset potential of the ORR in a PIL based fuel cell will depend on both the concentration of residual water and the PIL cation acidity. Plots of the potential-dependent data from EIS measurements in the complex capacitance plane (CCP) show that at least two differential double layer capacitances are present, depending on the cell potential U (vs. RHE), water concentration c(H2O) and temperature T. The double layer properties of the highly acidic [2-Sema][TfO] are significantly different compared to the less acidic PILs [1-EIm][TfO] and [Dema][TfO]. The potential dependent capacitance curves were discussed by taking a mean field model, the presence of water and short range correlations of ions into account. [4, 5] The combined electrochemical kinetics and double layer measurements provide a deeper insight into the double layer structure at the Pt electrode/PIL interface to reveal the rate limiting parameters of the ORR and its mechanism. [1] K. Wippermann, J. Giffin, S. Kuhri, W. Lehnert and C. Korte, Phys. Chem. Chem. Phys. 19, 24706 (2017) [2] K. Wippermann, Y. Suo and C. Korte, J. Phys. Chem. C 125(8), 8 (2021) [3] H. Hou, H. M. Schütz, J. Giffin, K. Wippermann, X. Gao, A. Mariani, S. Passerini and C. Korte, ACS Appl. Mater. Interfaces 13, 8370 (2021) [4] Z. A. H. Goodwin, G. Feng and A. A. Kornyshev, Electrochim. Acta 225, 190 (2017) [5] J. Friedl, I. I. E. Markovits, M. Herpich, G. Feng, A. A. Kornyshev and U. Stimming, ChemElectroChem 4, 216 (2017) Figure: ORR rate constant of PILs [HA+][X−] with different cation acidity vs. content of residual water (50 mol% H2O corresponds to 5–6 wt% H2O) Figure 1

APA, Harvard, Vancouver, ISO, and other styles

Abstract:

Abstract Background: T cell acute lymphoblastic leukemia (T-ALL) is an aggressive hematopoietic malignancy characterized by an aberrant proliferation of immature thymocytes affecting preferentially children and adolescents. Approximately 70% of T-ALL cases have activating mutations of the NOTCH1 followed by oncogenic pathways PI3K/Akt, the anti-apoptotic BCL-2 family, and CDKN2A/2B cell cycle regulators 1, 2. Unlike other leukemias such as chronic myeloid leukemia (CML) and Philadelphia-positive ALL, which are kinase-driven malignancies 3, 4, the initiating events in T-ALL cause the ectopic expression of transcription factors that drive leukemogenesis, hence targeted therapies needed to focused on this field. Cyclin Dependent Kinase 8 (CDK8) and its paralog CDK19, restrain activation of super-enhancer-associated tumor suppressors and lineage commitment genes in leukemia. Moreover CDK8 phosphorylates intracellular domain (ICD) and regulates activation and turnover of NOTCH1 5, 6, indicating that targeting CDK8 with specific inhibitors may be considered as a novel therapeutic strategy for T-ALL. RVU120 is a first-in-class, specific and selective inhibitor of CDK8/CDK19, currently in phase Ib dose-escalation trial in patients with relapsed or refractory (R/R) AML and HR-MDS (NCT04021368). Objectives: The goals of these studies were to investigated the effectiveness of RVU120 and other non-related CDK8/19 inhibitors against T-ALL cell lines/PDXs, including GSI-resistant lines. Comprehensive analysis of target inhibition and apoptotic signatures were evaluated. The clinical relevance of RVU120 in LICs was confirmed in Patient derived xenografts (PDXs). Results: T-ALL cell lines and PDXs were treated with RVU120 and other chemically non-related CDK8/19 inhibitors in different concentration for 12-18 days, and the changes in cell number and apoptosis using flow cytometry analysis were determined. High differential efficacy in double-digit nM range has been observed for NOTCH1 PEST domain mutant cell lines including GSI-sensitive HPB-ALL cells and GSI-resistant cells PF-382, KOPT-K1, and MOLT4, where both inhibition of cell proliferation and induction of apoptosis were observed. GI-resistant cell lines SUP-T1, SUP-T11, MOLT16 and JURKAT were considered as moderately sensitive and LOUCY (early T-cell phenotype ALL), and CCRF-CEM devoid those phenotype, were considered as resistant to RVU120. Results form etsblished cell lines were further corroborated in patient-derived xenograft cells (PDX) treated with RVU120. In T-ALL PDX 6522288 (Notch1 HD /PEST mut, TET2 mut, U2AF1 mut, WT1 mut and CUL76- CDKN2A/B mut, PTEN-/-) treatment with RVU120 was followed by a reduction in cell number and induction of apoptosis in phenotypically defined leukemia initiating cells (LICs) CD34+CD7+CD19-, with calculated IC50s value for bulk and LICs as 92.8 nM and 141.8 nM, respectively. The clinical relevance of these findings and impact on LICs are under the evaluation in PDX mice model. Mechanistically, treatment with RVU120 reduced the phosphorylation of STAT5 and STAT1 as well as the level of MYC and anti-apoptotic proteins MCL1, but induced expression of BAX in sensitive cells. Hence, inhibition of CDK8 is a novel approach to target the LICs in T-ALL. Conclusion: Inhibition of CDK8 by RVU120 triggers inhibition of cell proliferation and apoptosis in cell lines and LICs in T-ALL. Further clinical study is warranted to study the efficacy of RVU120 and CDK8 inhibition in T-ALL. Keywords: CDK8, RVU120, apoptosis, T-ALL, LICs in PDX model Reference 1 Girardi, T., Vicente, C., Cools, J. & De Keersmaecker, K. Blood129, 1113-1123, doi:10.1182/blood-2016-10-706465 (2017). 2 Sanchez-Martin, M. & Ferrando, A. Blood 129, 1124-1133, doi:10.1182/blood-2016-09-692582 (2017). 3 Braun, T. P., Eide, C. A. & Druker, B. J. Cancer cell 37, 530-542, doi:10.1016/j.ccell.2020.03.006 (2020). 4 Gazeau, N. et al. Leukemia 34, 2230-2233, doi:10.1038/s41375-020-0715-2 (2020). 5 Pelish, H. E. et al. Nature526, 273-276, doi:10.1038/nature14904 (2015). 6 Fryer, C. J., White, J. B. & Jones, K. A. Molecular cell 16, 509-520, doi:10.1016/j.molcel.2004.10.014 (2004). Disclosures Golas: Ryvu Therapeutics: Current Employment. Windak: Ryvu Therapeutics: Current Employment. Rzymski: Ryvu Therapeutics: Current Employment, Current equity holder in publicly-traded company. Andreeff: ONO Pharmaceuticals: Research Funding; AstraZeneca: Research Funding; Glycomimetics: Consultancy; Daiichi-Sankyo: Consultancy, Research Funding; Breast Cancer Research Foundation: Research Funding; Karyopharm: Research Funding; Reata, Aptose, Eutropics, SentiBio; Chimerix, Oncolyze: Current holder of individual stocks in a privately-held company; Amgen: Research Funding; Aptose: Consultancy; Medicxi: Consultancy; Oxford Biomedica UK: Research Funding; Novartis, Cancer UK; Leukemia & Lymphoma Society (LLS), German Research Council; NCI-RDCRN (Rare Disease Clin Network), CLL Foundation; Novartis: Membership on an entity's Board of Directors or advisory committees; Syndax: Consultancy; Senti-Bio: Consultancy. Borthakur: GSK: Consultancy; Astex: Research Funding; Takeda: Membership on an entity's Board of Directors or advisory committees; Ryvu: Research Funding; University of Texas MD Anderson Cancer Center: Current Employment; Protagonist: Consultancy; Novartis: Consultancy, Membership on an entity's Board of Directors or advisory committees; ArgenX: Membership on an entity's Board of Directors or advisory committees.

APA, Harvard, Vancouver, ISO, and other styles

Abstract:

Chloride ions (Cl−)-induced corrosion is one of the main degradation mechanisms in reinforced concrete (RC) structures. In most situations, the degradation initiates with the transport of Cl− from the surface of the concrete towards the reinforcing steel. The accumulation of Cl− at the steel-concrete interface could initiate reinforcement corrosion once a threshold Cl− concentration is achieved. An accurate numerical model of the Cl− transport in concrete is required to predict the corrosion initiation in RC structures. However, existing numerical models lack a representation of the heterogenous concrete microstructure resulting from the varying environmental conditions and the indirect effect of time dependent temperature and relative humidity (RH) on the water adsorption and Cl− binding isotherms. In this study, a numerical model is developed to study the coupled transport of Cl− with heat, RH and oxygen (O2) into the concrete. The modeling of the concrete microstructure is performed using the Virtual Cement and Concrete Testing Laboratory (VCCTL) code developed by the U.S. National Institute of Standards and Technology (NIST). The concept of equivalent maturation time is utilized to eliminate the limitation of simulating concrete microstructure using VCCTL in specific environmental conditions such as adiabatic. Thus, a time-dependent concrete microstructure, which depends on the hydration reactions coupled with the temperature and RH of the environment, is achieved to study the Cl− transport. Additionally, Cl− binding isotherms, which are a function of the pH of the concrete pore solution, Cl− concentration, and weight fraction of mono-sulfate aluminate (AFm) and calcium-silicate-hydrate (C-S-H), obtained from an experimental study by the same authors are utilized to account for the Cl− binding of cement hydration products. The temperature dependent RH diffusion was considered to account for the transport of Cl− with moisture transport. The temperature and RH diffusion in the concrete domain, composite theory, and Cl− binding and water adsorption isotherms are used in combination, to estimate the ensuing Cl− diffusion field within the concrete. The coupled transport process of heat, RH, Cl−, and O2 is implemented in the Multiphysics Object-Oriented Simulation Environment (MOOSE) developed by the U.S. Idaho National Laboratory (INL). The model was verified and validated using data from multiple experimental studies with different concrete mixture proportions, curing durations, and environmental conditions. Additionally, a sensitivity analysis was performed to identify that the water-to-cement (w/c) ratio, the exposure duration, the boundary conditions: temperature, RH, surface Cl− concentration, Cl− diffusion coefficient in the capillary water, and the critical RH are the important parameters that govern the Cl− transport in RC structures. In a case study, the capabilities of the developed numerical model are demonstrated by studying the complex 2D diffusion of Cl− in a RC beam located in two different climatic regions: warm and humid weather in Galveston, Texas, and cold and dry weather in North Minnesota, Minnesota, subjected to time varying temperature, RH, and surface Cl− concentrations.

APA, Harvard, Vancouver, ISO, and other styles

Abstract:

Potato plants (Solanum tuberosum cv. Ágata) exhibiting symptoms of leaf roll and interveinal chlorosis, especially on older leaves, were found in a commercial crop in the County of Cristalina, State of Goiás, Brazil in June 2011. The crop was severely infested by whitefly Bemisia tabaci biotype B. Four potato tubers from symptomatic plants were indexed for the presence of the following viruses: Tomato chlorosis virus (ToCV), Potato leaf roll virus (PLRV), Tomato severe rugose virus (ToSRV), and Potato virus Y (PVY). Total RNA was extracted separately from each tuber and used for reverse transcription (RT)-PCR using the HS-11/HS-12 primer pair, which amplifies a fragment of 587 bp from the highly conserved region of the heat shock protein (HSP-70) hom*olog gene reported for ToCV. The RT-PCR product was subsequently tested by nested-PCR for detection of ToCV with specific primers ToC-5/ToC-6 (2). Amplicons of 463 bp, amplified from total RNA separately extracted from three tubers, were purified and directly sequenced. Comparisons among the three consensus sequences of 448 bp (GenBank Accession Nos. JQ288896, JQ288897, and JQ288898) revealed respectively, 98, 100, and 100% identity with the reported sequence of a tomato isolate of ToCV from Brazil (GenBank Accession No. EU868927) (1). For ToSRV detection, total DNA was extracted from two tubers and a fragment of approximately 820 bp was amplified by PCR with specific primers (3). PLRV and PVY were indexed in two and three tubers, respectively, by double-antibody sandwich-ELISA (SASA, Edinburg, Scotland). Virus-free B. tabaci biotype B were separately transferred to potato and tomato leaves infected with ToCV for an acquisition access period of 24 h. Groups of 30 viruliferous whitefly were transferred to four, young, sprout-grown potato plants cv. Ágata (two plants per virus isolate) for 24-h inoculation access period. After 37 days of inoculation, one plant inoculated with the potato and tomato isolates of ToCV, respectively exhibited symptoms of leaf roll and interveinal chlorosis on order leaves, which were similar to that induced by PLRV. Experimental infection of potato plants with ToCV, which induced leaf roll symptoms resembling PLRV infection, was reported in the United States by Wisler et al. (4). The potato isolate of ToCV was also transmitted by B. tabaci to one of two inoculated tomato plants. The presence of ToCV in all inoculated plants was detected by nested-RT-PCR as described above. To our knowledge, this is the first report on detection of ToCV in field potato plants in the world. Considering that ToCV occurs in innumerous countries around the world, it is transmitted by a cosmopolitan insect, and it induces symptoms similar to PLRV, this finding triggers an alert to field dependent seed-potato multiplication, virus inspector, and certification system. References: (1) J. C. Barbosa et al. Plant Dis. 92:1709, 2008. (2) C. I. Dovas et al. Plant Dis. 86:1345, 2002. (3) F. R. Fernandes et al. Trop. Plant Pathol. 35:43, 2010. (4) G. C. Wisler et al. Plant Dis. 82:270, 1998.

APA, Harvard, Vancouver, ISO, and other styles

Abstract:

Abstract Background: MEDI5752 is a monovalent bispecific antibody targeting PD-1 and CTLA-4. The bispecific format is engineered to preferentially inhibit these two checkpoints on activated T cells in tumors, where co-expression is particularly abundant. This may maximize tumor-specific response and reduce the peripheral toxicity that is common when targeting these checkpoints independently. Here we present dose-escalation data from a phase I, open-label, multicenter study in advanced solid tumors (NCT03530397). Methods: Eligible patients (pts) were ≥18 years old (ECOG PS 0-1) with tumors not amenable to standard therapy. Pts were treated at 10 dose levels from 2.25-2500 mg IV Q3W until progression or unacceptable toxicity. Primary objectives were safety and identification of maximum tolerated dose (MTD). Secondary objectives included preliminary antitumor activity by RECIST v1.1, PK and immunogenicity. Exploratory objectives included evaluation of pharmacodynamic (PD) biomarkers. Results: At data cutoff (Sept 30, 2021), 86 pts (median age, 60.5 years; male, 75.6%; Asian, 57.0%) were enrolled. The most common tumor types were RCC (22.1%), NSCLC (16.3%), and head and neck cancer (8.1%); 95.2% had received prior systemic therapy and 90.7% were immunotherapy-naïve. MEDI5752 showed dose-dependent PK and sustained peripheral PD-1 receptor occupancy (&gt;90%) at doses &gt;225 mg. Dose-dependent increases in peripheral T cell proliferation (Ki67+) and activation (ICOS+) plateaued at doses ≥500 mg and demonstrated CTLA-4 specific blockade in the range of tremelimumab 6-10 mg/kg. At doses ≥500 mg, MEDI5752 significantly expanded new and existing T-cell clones, likely broadening the tumor antigen-driven T-cell response. Across all doses, objective responses were seen in 19.8% of pts (n=17, 1 complete and 16 partial [PR]). Median duration of response was 17.5 months. Molecular response (defined as ≥50% reduction in ctDNA) occurred in 36.5%. Doses ≥1500 mg (n=53) were poorly tolerated with Grade (G) 3/4 treatment-related AEs (TRAEs) in 50.9%; discontinuations due to TRAEs in 45.3%, and death in 1 (at 2000 mg). However, doses &lt;1500mg (n=33) had improved tolerability with G 3/4 TRAEs in 18.2% and discontinuations due to TRAEs in 9.1%. An MTD was not reached by protocol-defined DLT criteria. Immune-related AEs were also less common at doses &lt;1500 mg than at ≥1500 mg (G 3/4 in 18.2% vs 49.1%, respectively). Conclusions: MEDI5752 showed encouraging antitumor activity with durable clinical benefit. Doses &lt;1500 mg were better tolerated than doses ≥1500 mg. Treatment led to robust dual checkpoint blockade, evidence of T-cell activation and expansion of new and existing T-cell clones at pharmacodynamic levels that exceeded what is clinically feasible with dosing of conventional anti-PD-1 plus anti-CTLA-4 antibodies. MEDI5752 is now being explored at doses &lt;1500 mg in multiple expansion cohorts. Citation Format: Ben Tran, Mark Voskoboynik, Sang-We Kim, Charlotte Lemech, Enric Carcereny, Sun Young Rha, Myung-Ju Ahn, Enriqueta Felip, Ki H. Lee, Eduardo C. Alvarez, James Chih-Hsin Yang, Paolo A. Ascierto, Mariano P. Pulla, Dan Freeman, Xuyang Song, Shelby D. Gainer, Patrick Mitchell, Ikbel Achour, Deepa S. Subramaniam, Seock-Ah Im. MEDI5752, a novel PD-1/CTLA-4 bispecific checkpoint inhibitor for advanced solid tumors: First-in-human study [abstract]. In: Proceedings of the American Association for Cancer Research Annual Meeting 2022; 2022 Apr 8-13. Philadelphia (PA): AACR; Cancer Res 2022;82(12_Suppl):Abstract nr CT016.

APA, Harvard, Vancouver, ISO, and other styles

Abstract:

For proton-exchange-membrane fuel cells (PEMFCs) to achieve broad commercialization, improved energy-conversion efficiency with minimal Pt-based electrocatalyst is required [1]. Because the sluggish rate of oxygen reduction reaction (ORR) limits the efficiency of PEMFCs [2], the efficiency improvement requires a better understanding of ORR kinetics and mechanism to design better catalyst. To understand the ORR mechanism, theoretical and experimental analyses have been conducted. While previous studies reasonably explained the catalyst-dependent activity on single crystal catalysts in 0.1 M perchloric acid solution [3, 4], the explicit effect of electrolyte and related microenvironments [5, 6] is not thoroughly understood. The change in the electrolyte alters the electric-double-layer (EDL) structure and thus the local microenvironment at the electrode/electrolyte interface. Thus, the structure of the EDL should be carefully analyzed to uncover the electrolyte-dependent reaction kinetics. In this talk, we propose a multiscale continuum model to predict the EDL structure and examine the effect of perchloric acid concentration on ORR activity on Pt (111). The model includes Density Potential Functional Theory (DPFT) for electron density and Modified Poisson Boltzmann equation for species’ density and electric potential [7]. Also, the interaction between adsorbents and electric field is taken into account by minimizing the grand potential. After model validation with experimentally measured double-layer capacity data as a function of applied potential and concentration, the effect of the perchloric acid concentration (0.02 M – 0.2 M) on ORR activity is analyzed and discussed. It is shown that the model reproduces the specific activity obtained in the experiments when assuming the oxygen adsorption is limiting the rate, which can be attributed to the large energetic barrier for solvent reorganization [8]. Then, extension of the model to PEMFC ionomer electrolytes will be introduced. Overall, the model framework and findings provide insights into the ORR mechanism and guidance on how to tailor catalyst materials for increased PEMFC performance. Acknowledgements: This work was partially supported by the Hydrogen and Fuel Cell Technologies Office (HFTO), Office of Energy Efficiency and Renewable Energy, U.S. Department of Energy (DOE) through the Million Mile Fuel Cell Truck (M2FCT) consortia, technology managers G. Kleen and D. Papageorgopoulos, under contract number DE-AC02- 05CH11231, as well as by a CRADA with Toyota Central R&D Labs., Inc.. Reference [1] D. A. Cullen, K. C. Neyerlin, R. K. Ahluwalia, R. Mukundan, K. L. More, R. L. Borup, A. Z. Weber, D. J. Myers and A. Kusoglu, Nature Energy, 6, 462 (2021). [2] I. E. L. Stephens, A. S. Bondarenko, U. Grønbjerg, J. Rossmeisl and I. Chorkendorff, Energy & Environmental Science, 5 (2012). [3] M. Shibata, M. Inaba, K. Shinozaki, K. Kodama and R. Jinnouchi, Journal of The Electrochemical Society, 169 (2022). [4] H. A. Hansen, V. Viswanathan and J. K. Nørskov, The Journal of Physical Chemistry C, 118, 6706 (2014). [5] K. Kodama, K. Motobayashi, A. Shinohara, N. Hasegawa, K. Kudo, R. Jinnouchi, M. Osawa and Y. Morimoto, ACS Catalysis, 8, 694 (2017). [6] M. Luo and M. T. M. Koper, Nature Catalysis, 5, 615 (2022). [7] J. Huang, J Chem Theory Comput, 19, 1003 (2023). [8] D. T. Limmer, A. P. Willard, P. Madden and D. Chandler, Proceedings of the National Academy of Sciences, 110, 4200 (2013).

APA, Harvard, Vancouver, ISO, and other styles

Abstract:

Arsenic and Protein Expression: It might help to know the mechanism of As toxicity is described Introduction One of the largest public health problems at present is the drinking of water containing levels of Inorg-As that are known to be carcinogenic. The chronic ingestion of Inorg-As can results in skin cancer, urinary bladder cancer, lungs cancer, kidneys cancer, liver cancer, and cancer of other human organs 1-6. The molecular mechanisms of the carcinogenicity and toxicity of inorganic arsenic are not well understood 7–9. Many mechanisms of arsenic toxicity and carcinogenicity have been suggested 1, 7, 10 including chromosome abnormalities 11, oxidative stress 12, 13, altered growth factors 14, cell proliferation 15, altered DNA repair 16, altered DNA methylation patterns 17, inhibition of several key enzymes 18, gene amplification 19 etc. Some of these mechanisms result in alterations in protein expression. Proteomics is a powerful tool developed to enhance the study of complex biological system 20. This technique has been extensively employed to investigate the proteome response of cells to drugs and other diseases 21, 22. A proteome analysis of the Na-As (III) response in cultured lung cells found in vitro oxidative stress-induced apoptosis 23. In one of the study, hamsters were exposed to sodium arsenite (173 mg As/L) in drinking water for 6 days and several protein spots were over expressed and several were under expressed in the livers and urinary bladders of hamsters (Fig.) 24, 25. Hamsters were exposed to sodium arsenite (173 mg As/L) in drinking water for 6 days. The control hamsters were given tap water. The spot pairs of (A) equally expressed, (B) overexpressed, and (C) under expressed proteins in the liver tissues were shown. The amount of the protein is proportional to the volume of the protein peak. Transgelin was down-regulated, and GST-pi was up-regulated in the urinary bladder tissues of hamsters. In the liver tissues ornithine aminotransferase (OAT) was up-regulated, and senescence marker protein 30 (SMP 30), and fatty acid binding protein (FABP) were down-regulated. Down-regulation of transgelin has been noted in the urinary bladders of rats having bladder outlet obstruction 26. Ras-dependent and Ras-independent mechanisms can cause the down regulation of transgelin in human breast and colon carcinoma cell lines and patient-derived tumor samples 27. The loss of transgelin expression has been found in prostate cancer cells 28 and in human colonic neoplasms 29. It has been suggested that the loss of transgelin expression may be an important early event in tumor progression and a diagnostic marker for cancer development 26-29. Figure. Three-dimentional simulation of over-and under expressed protein spots in the livers of hamsters using Decyder software. Over-expression of GST-pi has been found in colon cancer tissues 30. Strong expression of GST-pi also has been found in gastric cancer 31, malignant melanoma 32, lung cancer 33, breast cancer 34 and a range of other human tumors 35. GST-pi has been up-regulated in transitional cell carcinoma of human urinary bladder 36. OAT has a role in regulating mitotic cell division and it is required for proper spindle assembly in human cancer cell 37. Ornithine amino transferase knockdown in human cervical carcinoma and osteosarcoma cells by RNA interference blocks cell division and causes cell death 37. It has been suggested that ornithine amino transferase has a role in regulating mitotic cell division and it is required for proper spindle assembly in human cancer cells 37. SMP 30 expressed mostly in the liver. By stimulating membrane calcium-pump activity it protects cells against various injuries 38. High levels of saturated, branched chain fatty acids are deleterious to cells and resulting in lipid accumulation and cytotoxicity. FABP expression has protected the cells against branched chain saturated fatty acid 39. Proteomics would be a powerful tool to know the unknown cellular mechanisms of arsenic toxicity in humans. References. NRC (National Research Council). (2001). Arsenic in Drinking Water. Update to the 1999 Arsenic in Drinking Water Report. National Academy Press, Washington, DC. Chen, C. J., Chen, C. , Wu, M. M., Kuo, T. L. (1992). Cancer potential in liver, lung, bladder, and kidney due to ingested inorganic arsenic in drinking water. Br. J. Cancer 66, 888-892. Hopenhayn-Rich, C., M.L. Biggs, A. Fuchs, et al. 1996. Bladder cancer mortality with arsenic in drinking water in Argentina. Epidemiology 7: 117–124. International Agency for Research on Cancer. (1987). In IARC Monograph on the Evaluation of Carcinogenicity Risk to Humans. Overall Evaluation of Carcinogenicity:An Update of IARC Monographs 1–42 (Suppl. 7). Lyon, France: International Agency for Research on Can-cer, pp. 100–106. Rossman, T.G., Uddin, A.N., and Burns, F.J. (2004). Evidence that arsenite acts as a cocarcinogen in skin cancer. Toxicol. Appl. Pharmacol. 198: 394–404. Smith, A.H., Hopenhayn-Rich, C., Bates, M.N., et al. (1992). Cancer risks from arsenic in drinking water. Environ. Health Perspect. 97: 259–267. Aposhian, H.V. & Aposhian, M.M. (2006). Arsenic toxicology: five questions. Chem. Res. Toxicol. 19: 1–15. Goering, P.L., Aposhian, H.V., Mass, M.J., et al. (1999). The enigma of arsenic carcinogenesis: role of metabolism. Toxicol. Sci. 49: 5–14. Waalkes, M.P., Liu, J., Ward, J.M., et al. (2004). Mechanisms underlying arsenic carcinogenesis: hypersensitivity of mice exposed to inorganic arsenic during gestation. Toxicology 198: 31–38. Kitchin, K. T., Recent advances in arsenic carcinogenesis: modes of action, animal model systems, and methylated arsenic metabolites. Appl. Pharmacol. 2001, 172, 249-261. Beckman, G., Beckman, L., Nordenson, I., Chromosome aberrations in workers exposed to arsenic. Environ. Health Perspect. 1977, 19, 145-146. Yamanaka, K., Hoshino, M., Okanoto, M., Sawamura, R., et al., Induction of DNA damage by dimethylarsine, a metabolite of inorganic arsenics, is for the major part likely due to its peroxyl radical. Biophys. Res. Commun. 1990, 168, 58-64. Yamanaka, K., Okada, S., Induction of lung-specific DNA damage by metabolically methylated arsenics via the production of free radicals. Health Perspect. 1994, 102, 37-40. Simeonova, P., Luster, M. I., Mechanisms of arsenic carcinogenicity:Genetic or epigenetic mechanisms? J. Environ. Pathol. Toxicol. Oncol. 2000, 19, 281-286. Popovicova, J., Moser, G. J., Goldsworthy, T. , Tice, R. R., Carcinogenicity and co-carcinogenicity of sodium arsenite in p53+/- male mice. Toxicologist 2000, 54, 134. Li, J. H., Rossman, T. G., Mechanism of co-mutagenesis of sodium arsenite with N-methyl-N-nitrosourea. Bi Trace Elem. 1989, 21, 373-381. Zhao, C. Q., Young, M. R., Diwan, B. A., Coogan, T. P., et , Association of arsenic-induced malignant transformation with DNA hypomethylation and aberrant gene expression. Proc. Natl. Acad. Sci. USA 1997, 94, 10907-10912. Abernathy, C. O., Lui, Y. P., Longfellow, D., Aposhian, H. , et al., Arsenic: Health effects, mechanisms of actions and research issues. Environ. Health Perspect. 1999, 107, 593-597. Lee, T. C., Tanaka, N., Lamb, P. W., Gilmer, T. M., et al., Induction of gene amplification by arsenic. Science 1988, 241, 79-81. Lau, A. T., He, Q. Y., Chiu, J. F. (2003). Proteomic technology and its biomedical applications. Acta Biochim. Bioph Sin. 35, 965-975. Jungblut, P. R., Zimny-Arndt, U., Zeindl-Eberhart, E., Stulik, J., Koupilova, K., Pleissner, K. P., Otto, A., Muller, E. C., Sokolowska-Kohler, W., Grabher, G., Stoffler, G. (1999). Proteomics in human disease: cancer, heart and infectious diseases. Electrophoresis 20, 2100-2110. Hanash, S. M., Madoz-Gurpide, J., Misek, D. E. (2002). Identification of novel targets for cancer therapy using expression proteomics. Leukemia 16, 478-485. Lau, A. T., He, Q. Y., Chiu, J. F. (2004). A proteome analysis of the arsenite response in cultured lung cells: evidence for in vitro oxidative stress-induced apoptosis. J. 382, 641-650. Chowdhury, U. K., Aposhian, H. V. (2008). Protein expression in the livers and urinary bladders of hamsters exposed to sodium arsenite. A N. Y. Acad. Sci. 1140, 325-334. Chowdhury, U.K. Expression of proteins in the tissues of hamsters exposed to sodium arsenite. Int. J. of Toxicol., 2021, 1, 1-8. Kim, H-J., Sohng, I., Kim, D-H., Lee, D-C., et al., 2005. Investigation of early protein changes in the urinary bladder following partial bladder outlet obstruction by proteomic approach. J. Korean Med. Sci. 20, 1000-1005. Shields, J.M., Rogers-Graham, K., Der, C.J., 2002. Loss of transgelin in breast and colon tumors and in RIE-1 cells by Ras deregulation of gene expression through Raf-independent pathways. J. Biol. Chem. 277, 9790-9799. Yang, Z., Chang, Y- J., Miyamoto, H., Ni, J., et al., Transgelin functions as a suppressor via inhibition of ARA54-enhanced androgen receptor transactivation and prostate cancer cell grown. Mol. Endocrinol. 2007, 21, 343-358. Yeo, , Kim, D- K., Park, H. J., Oh, T. Y., et al., Loss of transgelin in repeated bouts of ulcerative colitis-induced colon carcinogenesis. Proteomics 2006, 6, 1158-1165. Tsuchida, S., Sekine, Y., Shineha, R., Nishihira, T., et al., Elevation of the placental glutathione S-transferase form (GST-PI) in tumor tissues and the levels in sera of patients with cancer. Cancer Re 1989, 43, 5225-5229. Tsutsumi, M., Sugisaki, T., Makino, T., Miyagi, N., et al., Oncofetal expression of glutathione S-transferase placental form in human stomach carcinomas. 1987, 78, 631-633. Mannervik, B., Castro, V. M., Danielson, U. H., Tahir, M. K., et , Expression of class Pi glutathione transferase in human malignant melanoma cells. Carcinogenesis (Lond.) 1987, 8, 1929-1932. Di llio, C., Del Boccio, G., Aceto, A., Casaccia, R., et al,. Elevation of glutathione transferase activity in human lung tumor. Carcinogenesis (Lond.) 1988, 9, 335-340. Sreenath, A. S., Ravi, K. K., Reddy, G. V., Sreedevi, B., et al., Evidence for the association of synaptotagmin with glutathione S- transferase: implications for a novel function in human breast cancer. Clinical Biochem. 2005, 38, 436-443. Shea, T. C., Kelley S. L, Henner, W. D., Identification of an anionic form of glutathione transferase present in many human tumors and human tumor cell lines. Cancer Res. 1988, 48, 527-533. Simic, T., Mimic-Oka, J., Savic-Radojevic, A., Opacic, M., et al., Glutathione S- transferase T1-1 activity upregulated in transitional cell carcinoma of urinary bladder. Urology 2005, 65, 1035-1040. Wang, G., Shang, L., Burgett, A. W. G., Harran, P. G., et al., Diazonamide toxins reveal an unexpected function for ornithine d-amino transferase in mitotic cell division. PNAS 2007, 104, 2068-2073. Fujita, T., Inoue, H., Kitamura, T., Sato, N., et a, Senescence marker protein-30 (SMP30) rescues cell death by enhancing plasma membrane Caat-pumping activity in hep G2 cells. Biochem. Biophys. Res. Commun. 1998, 250, 374-380. Atshaves, B. P., Storey, S. M., Petrescu, A., Greenberg, C. C., et al., Expression of fatty acid binding proteins inhibits lipid accumulation and alters toxicity in L cell fibroblasts. A J. Physiol. Cell Physiol. 2002, 283, C688-2703.

APA, Harvard, Vancouver, ISO, and other styles

Abstract:

In March 2011, interveinal yellowing and necrosis symptoms on middle and lower leaves were observed in tomato (Solanum lycopersicum L., cv. Castle Rock) plants grown in three adjacent greenhouses of the Agricultural Research Corporation at Wad Medani (Gezira State, Sudan). These symptoms resembled those caused by Tomato chlorosis virus (ToCV) and Tomato infectious chlorosis virus (TICV) (4) (genus Crinivirus, family Closteroviridae). Whitefly (Bemisia tabaci) infestation was also observed in these greenhouses. Total RNA was extracted by TRIzol Reagent (Invitrogen, Carlsbad, CA) from symptomatic leaves and analyzed by dot-blot hybridization with digoxigenin-labelled RNA probes to the coat protein (CP) gene of ToCV and to the minor coat protein (CPm) gene of TICV. Positive signal was obtained only with the ToCV probe. Reverse transcription (RT)-PCR reactions were performed with two pairs of primers specific for the detection of ToCV, MA380(+) (5′-GTGAGACCCCGATGACAGAT-3′) and MA381(-) (5′-TACAGTTCCTTGCCCTCGTT-3′), specific to the CP gene (ToCV RNA 2) (3), and MA396(+) (5′-TGGTCGAACAGTTTGAGAGC-3′) and MA397(-) (5′-TGAACTCGAATTGGGACAGA-3′), specific to the RNA-dependent RNA polymerase (RdRp) gene (ToCV RNA 1) (1). DNA fragments of the expected sizes (436 and 763 bp, respectively) were obtained, thus supporting the presence of ToCV in the symptomatic samples. Amplified DNA fragments were cloned in pGEM-T Easy vector (Promega, Madison, WI) and one clone per amplicon was sequenced (Macrogen Inc., Seoul, South Korea). The highest nucleotide sequence identity of the CP gene fragment obtained (GenBank Accession No. JN411685) was 99.2% related with North American ToCV isolates from Florida (DQ234674), Colorado (DQ234675), and Georgia (HQ879842), while the RdRp gene fragment (JN411686) was more closely related (99.0%) to the Spanish AT80/99 isolate (DQ983480). Although yellowing symptoms similar to those reported here have been observed sporadically during the last few years in open-field tomato crops in the state of Gezira, additional studies are needed to determine the prevalence and economic impact of ToCV infections in tomato cultivation in Sudan. To our knowledge, ToCV has been found in continental Africa only in Morocco and South Africa, in the Mediterranean climate areas in the northern and southern edges of the continent, respectively (2). The finding of ToCV infecting tomato in Sudan raises the question of whether this virus is emerging also in other tropical areas of the continent and illustrates the need to monitor whitefly-infested areas within Africa for the presence of ToCV. References: (1) G. Lozano et al. J. Virol. 83:12973, 2009. (2) J. Navas-Castillo et al. Annu. Rev. Phytopathol. 49:219, 2011. (3) H. P. Trenado et al. Eur. J. Plant Pathol. 118:193, 2007. (4) G. C. Wisler et al. Plant Dis. 82:270, 1998.

APA, Harvard, Vancouver, ISO, and other styles

Abstract:

The fundamental methodological development of the categorical matrix as one of the most powerful and the most effective i n s t r u m e n t s of reflexive thought-activity, philosophical and scientific thought-activity and professional methodologization was carried out in the problem field of two oppositely directed and at the same time most promising trends in the methodology development as a newly appeared w o r l d of birth, development and manifestation of hitherto unexplored possibilities of conscious ability and hidden resources of humans pure thinking actualization. The first direction in the formation of this unique world is connected with the emergence of the s p h e r e of professional methodologization as a unique reflexive p r a c t i c e of the methodology itself, the essence of which is in the freedom of thought existence of a person or a group with the forms, methods, means of consciously and self-consciously carried out activity, the second – in the creation of all possible i d e a l s of meta-theorizing and meta-methodologization, where the subject of the last is an a r s e n a l of the latest means and tools of constantly renewed at the “meta-” level of methodological reflection on previously acquired tools of thought-activity. It is argued that the synthesis result of these two trends is the formation of the categorical order of a methodology in its central link – in the innovative form of the categorical m a t r i x, which integrates the essential, worldview universal and culturally significant k n o w l e d g e in mutually complementary unity of the methodology-as-an-action and methodology-as-a-practice. Based on the principles, regularities and standards of the author’s concept of creating a categorical matrix, a thought-reflexive substantiation received the first and the second v e r s i o n s of the philosophically oriented, epistemically integral, actionally organized and canonically perfected vita-cultural methodology as a s t a n d a r d of modern methodology in general in their constructive comparison as stages of the newest evolution of ratio-humanitarian knowledge about the forms, methods, norms, means and tools of professional methodologization. In general, the methodological o p t i c s of the argued typological creation of the named matrix is constructed according to the canons and parameters of post-non-classical scientific rationality and in the form of a five-module set of lenses-instruments of reflexive thought-activity from relatively simple to the most complex at the following levels: specific (quaternary or quintet thought-scheme), individual (the very construction of the matrix in the unity of its clearly classified according to the dialectical categories of the inner part and the outer contour), special (the typological approach in the indivisibility of its concepts, principles, procedures and intellectual tools), general (the sphere of professionally implemented methodologization), universal (vitacultural methodology as the canonical form of methodology in general). T h e f i r s t version of the categorical matrix of the world of methodology and the sphere of methodologization, which was created in early 2012 and first presented to the general public of researchers, has five main a d v a n t a g e s: a) in the harmonized picture of conceptual-categorical means highlights the dialectical complementarity and ontophenomenal unity of methodology and methodologization that enables a high functional self-organization of consciousness of the methodologists’ group in its synergistic existential environment – in reality of pure thinking; b) in the central part of the matrix, by the principle of quintet, arranges five methodological categories in horizontal and vertical, organizing them into separate categorical t a x a, and thus fixes the essential categoric mosaic of the modern methodology; c) successfully names the binary poles of the matrix’s outer contour: “the world of methodology – the sphere of methodologization” and “thinking-activity as the basis of culture – a step-by-step implemented vitacultural methodologization”; d) establishes the latest methodological disciplines – methodosophy, methodologics, methodoengineering – and outlines their subject fields in the text; e) at the intersection of the three fundamentals of the methodology in the lower right corner of the matrix, it places the fourth foundation – philosophical methodologizations and methodology, which at the level of comprehensively significant goes beyond empirics and social experience into conscious acts of the substance existence of pure thinking, the existential c o r r e l a t e of which is a methodological thinking. T h e s e c o n d version of the categorical matrix of vitacultural methodology, which was designed this year, has more extensive and perfect cartography, which primarily from now on concerns the two-axis – semantic and categorical – its outer contour. This newly created matrix has five reflexively reasoned a d v a n t a g e s, which at the same time clearly establish the evolutionary shift in the development of methodological knowledge over the past decade of thinking-deed creativity: 1) fundamental categorical universals, consolidating the self-development unity of the world of the methodology and the sphere of methodologization of the outer contour, received clarifying conceptual-terminological definitions, covering six attributedly inherent features in the general direction of creating a particularly favorable, modular-developmental, space of actualization and existentializing the expanded conscious ability of each participant of problem-conflict communication; 2) the upper and lower poles of the matrix’s outer contour are considered, on the one hand, the methodology as an obligatory component of culture in eight coordinates of worldview here-existence and in its semantic, graphic-schematic, means-instrumental and conceptual-categorical enrichment, on the other – a five-level organization of methodological knowledge (philosophical, general scientific, subject-scientific, subject-thematic and specific-situational methodologies), the operation of which is most fully implemented in the metasystem of vitacultural (canonical) methodologization; 3) the latest methodology, essentially based on philosophical knowledge, one of the most important directions of its development justifies the need for methodological reconstruction of the main problems of philosophy, but from a special, supersubjective, reflexive, point of view: from the completeness of the a d e q u a c y of consciously applied foundations, principles, rules, conceptual resources and categorical means of the complexity or comprehended primacy of a separate fundamental problem; a number of such problems are fixed in the outline of the matrix: “being – consciousness,” “human – world,” “culture – life,” “philosophy – social experience,” “science – art,” “theory – practice,” “consciousness (thinking) – activity,” “thinking – commitment,” “thought – act”; at the same time, super-reflexive transformations in these problematic niches of methodologization should be based on the innovative achievements of advanced methodological training, namely, on the modern achievements of the philosophical methodology, the reflexive-action scenario of metamethodologization has been worked out, the emergence of the metatheory of consciousness, the methodological optics of the post-non-classical type of scientific rationality and on the establishment of professional methodologization as a unique freedom-practice of the methodology itself, as well as compliance with the requirements of the author’s principle of the thinking and performance unity, that received an essential reflection in the concept and categorical concept of “thinking-activity,” containing a set of advantages: enriches the arsenal of categorical means, makes possible the implementation of a cyclic-action approach and the prospects for the implementation of organizational-action games, reorients the intellectual resources of consciousness to the canonical rhythms of methodologization; 4) the methodology in its separate formation now goes to the realisation of exemplary, canonically completed events of its own here-existence, that is, to the construction of the general scheme of the methodological canon and the substantiation of their more or less complete systematics; it is proved that any repeated reflexivity and especially postaction super-reflexivity in a competent methodological performance gravitate to an deed canon, which is a methodological i n v a r i a n t as one of its vitacultural standards, that is differently implemented in objectified products of professional methodologization and pure thinking itself (a vivid example of such a canon is the author’s methodological optics of a five-module set of lenses-tools of this study as an effective thinking-activity); it is argued the intransitive significance of the logical structure of the psychological canon and the premises of the emergence of the V.A. Romenets’ canonical psychology and our experience in carrying out the metatheoretic reconstruction of the subject field of the last; through a chain of generalizations, it is confirmed that the vitacultural methodology, covering transcendent and immanent, noumenal and phenomenal, conscious and active, is a great thinking-act c a n o n, confirming the following preliminary conclusions: a) any canonization as a mandatory procedure is a matter of methodology, b) each philosophically mature, scientifically comprehensive and empirically validated methodology constitutes a great canon, c) from the idea of the methodological canon it is necessary to move to the elaboration of the hierarchical system of such canons as the most perfect organizations of realizing the conscious ability of a person, d) a holistic metasystem of methodology as a canon of a great deed can be obtained only by using all available resources of professional methodologization and at the final stage of its super-reflexive postact, e) the methodological canon in its global dimensions, organizing the interpenetration of methodology and methodologization as two mega-realities, has a hierarchically modular, step-by-step construction (methodological and metamethodological stages of development, three methodological optics of scientific rationality, a set of methodological approaches, five methodological modules, various layers of methodological tools), f) in any case, the methodological canon is a consciously mature, with access to reflection and self-reflection, the source of a standard carried out thinking-activity, an integral engine of the act of full-fledged methodologization; 5) the vitacultural methodology in its canonical provision achieves the complete realisation of the a c t i o n s of thinking-activity, methodological reflection, competent methodologization in their single and exceptional step-by-step, mostly covital, existence as responsible thinking-activity; so the ideal-real, exemplary authentic reality of methodologization appears, which all the time is being created anew in the event e x i s t e n c e of compatible thought communication on the verge of transcendental and immanent, noumenal and phenomenal, spiritual and natural, substantive and random, unknown and understandable, objective and subjective, organized and chaotic, developing and ossified, that is, in the situational flow of the here-existence of the step-by-step-dependent substances of consciousness, thinking, thought according to the canon “here-now-full-always”; in this interpretation, the newly created categorical matrix constitutes one of the most instrumentally perfect methodological canons of the methodology itself, where the act of methodologization unfolds as a component-by-component evolution of a fully realized e v e n t, which covers: p r e-s i t u a t i o n – the experience of transcendence of the thinking person as a base of the co-rhythmic actualization of their intentional fields of consciousness and thinking; s i t u a t i o n – the acting-cyclical creation of the modular-developmental space of team thinking-implementation as a regularly stable restoration of the special problem-communication tension of human essential forces, characterized by common significance, transcendental source, collision, drama; m o t i v a t i o n – overcoming the conflict of problem-situational reality, overcoming the chaos of polymotivation of participants in thought-communication and choosing the general direction of movement-progress forward, which is confirmed in such features of methodologization as the elimination of conflict conditions and the formation of a single goal of further cooperation, the development of synthetic inspiration for joint entry into the substance flows of pure productive thinking and the correlation of the main vector of the polymotivation field with a reflexive ideal of methodological creativity; d e e d a c t i o n – a thinking-active action that significantly disrupts the problem-conflict situation through the creation of favorable conditions for the spontaneous fountain of thoughts, ideas, meanings, and thought-schemes of communicants, but in the self-organizational weaving of the pulsation of the consciousness functionals on the verge of the apogee of ecstatic, self-absorbing, tension of spiritual forces and mental abilities of each, combining four attributive characteristics of methodologization: implementation of the very act-event of thinking-activity, variable-changeable scenario of the course of this step-by-step action in order to obtain the desired products of pure thinking and polyreflexification, achievement of creative ecstasy of the team search for ways and means of solving the worked-out problem, personal growth and enrichment of the transcendental experience of participants; a f t e r a c t i o n – final reflection and the resulting self-reflection of productivity and success of team or individually performed thinking-activity and coverage with an expanded conscious view in a position over k n o w l e d g e of four types: about objects, about the activity itself, reflective and purely personal; at the same time, the incompleteness of the act of methodologization after achieving the goal and solving the dual task of intellectual cooperation has several reasons (ontological inexhaustibility of being, its phenomenal diversity, epistemological infinity of the path to truth, epistemological unlimitedness and relativity of the world, psychological ambivalence of feelings after the commited, the impossibility of creating an absolutely universal methodological optics), while its attributive canon is the implementation of reflexive-action closure of methodological thinking with various reflexive identifications.

APA, Harvard, Vancouver, ISO, and other styles

Abstract:

Abstract Severe hemolysis and associated high levels of hemolytic biomarkers, including LDH and heme, are among major constituents of the pathophysiology of sickle cell disease (SCD). Elevated extracellular heme due to hemolysis overwhelms endogenous detoxification mechanisms and leads to oxidative stress, triggering systemic endothelium activation, vascular dysfunction, and end organ damage. To understand the role of red blood cells (RBC) in this process, we assessed sickle RBC adhesion to heme-activated endothelial cells utilizing an endothelialized microfluidic platform in a clinically diverse patient population. Human umbilical vein endothelial cells (HUVECs) were seeded into fibronectin (FN) functionalized microfluidic channels and incubated for 4 hours in a 37°C and 5% CO2 environment. Next, the confluent monolayers were loaded and incubated for 45 minutes with fresh culture medium or at one of two concentrations of heme solutions: (1) 20 μM that corresponds to physiological heme levels in SCD patients, and (2) 40 μM. SCD blood samples, collected from 8 patients (7 HbSS and 1 HbS/β0 thal; 3 males and 5 females), were centrifuged to remove the plasma and washed with PBS thrice prior to flow experiments. RBCs were re-suspended in culture medium at a hematocrit of 25%. A total volume of 15 µl RBC suspension was perfused into the microchannels followed by rinsing with fresh culture medium at 1 dyne/cm2, which corresponds to the typical shear stress value observed in post-capillary venules. The fully closed and hermetically sealed microfluidic system design ensured the stability of gas composition in the culture medium during the experiments. Endothelialized microchannels supported sickle RBC adhesion to non-treated, 20 µM heme-activated, and 40 µM heme-activated HUVECs (Fig. 1A, B, C). Adhesion results suggested that activation of HUVECs by heme mediated RBC adhesion in a concentration-dependent manner, with a significant difference observed at 40 µM (Fig. 1D, paired t-test, p&lt;0.05). Notably, a heterogeneous heme-mediated adhesion profile was seen among patients. Sickle RBC adhesion to 20 μM heme-activated HUVECs was significantly increased in patients with higher LDH levels (Fig. 1E, p=0.024, ANOVA), higher absolute reticulocyte counts (Fig. 1F, p=0.002, ANOVA), and lower total hemoglobin (Fig. 1G, p=0.016, ANOVA), which are indicative of elevated hemolysis. All patients in the high adhesion group (&gt;200 adherent RBCs) had elevations in serum LDH levels and in absolute reticulocyte counts. Moreover, patients with a recent transfusion had higher RBC adhesion to 40 µM heme-activated HUVECs compared to patients with no transfusion in the last 3 months (Fig. 1H, p&lt;0.05, ANOVA). Here, we report a direct link between heme-driven endothelial activation and RBC adhesion in a patient-specific manner. In patients with a more severe clinical phenotype, as reflected in LDH, total hemoglobin, and absolute reticulocyte or recent blood transfusions, we found greater RBC adhesion to heme-activated HUVECs. These findings suggest that RBCs from those patients most likely to experience hemolysis in vivo may also be those RBCs most likely to adhere to heme-activated endothelium. Acknowledgments: This work was supported by grants #2013126 and #2015191 from the Doris Duke Charitable Foundation, National Heart Lung and Blood Institute R01HL133574, and National Science Foundation CAREER Award 1552782. Figure 1: Sickle RBC adhesion to heme-activated HUVECs and clinical associations. Sickle RBCs adherent to immobilized HUVECs in (A) non-activated, (B) 20 µM heme-activated, and (C) 40 µM heme-activated microchannels. The microscope images illustrate a small portion of the full microchannel surface. (D) RBC adhesion to HUVECs increased depending on the heme concentration, with a significant difference at the 40 µM level (paired t test, p&lt;0.05). Patients with higher LDH (E) as well as absolute reticulocyte counts (F), and lower total hemoglobin (G) showed significantly greater RBC adhesion to 20 µM heme-activated HUVECs (ANOVA). (H) Furthermore, patients with a recent transfusion history displayed elevated RBC adhesion to 40 µM heme-activated HUVECs compared to non-transfused patients (ANOVA). The dashed rectangles indicate the normal clinical values for healthy individuals, while all patients had total hemoglobin levels lower than normal. Scale bars represent 30 µm. Figure 1 Figure 1. Disclosures Little: Hemex Health: Equity Ownership. Gurkan: Hemex Health: Employment, Equity Ownership.